To be Host or not to be: Finding Sustainable Management through Endophyte Interactions

Final report for GNE17-144

Project Type: Graduate Student
Funds awarded in 2017: $15,000.00
Projected End Date: 08/31/2019
Grant Recipient: The Pennsylvania State University
Region: Northeast
State: Pennsylvania
Faculty Advisor:
Dr. Maria del Mar Jimenez-Gasco
The Pennsylvania State University
Expand All

Project Information

Summary:

Verticillium dahliae is a worldwide distributed fungal plant pathogen that can cause disease in over 400 different plant species including potatoes. Because of the limited availability of disease-resistant potato cultivars, Verticillium wilt epidemics are primarily managed with soil disinfestation using soil fumigants, and rotations with crop species traditionally considered to be non-hosts. Unfortunately, crop rotations do not perform as expected and few past studies revealed that V. dahliae can infect some rotational crops and weeds as an endophyte (i.e. without causing disease symptoms). Verticillium dahliae populations are divided into a number of evolutionary clonal lineages and isolates have variations in pathogenicity and virulence depending on their evolutionary lineage. V. dahliae lineages 4A and 4B are often associated with potato agroecosystem with 4A isolates being highly aggressive to most commercial potato cultivars compared to lineage 4B isolates. Preliminary work in our lab has shown that lineage 4B isolates can cause disease on potatoes and also infect numerous rotational crops and weeds in potato fields without causing symptoms. It is important to elucidate if inoculum from lineage 4B isolates is produced in asymptomatic rotational crops, determine the levels and how that affect to subsequent potato crops planted in the field. In addition, if lineage 4A isolates, highly aggressive to potato, are also able to infect rotational crops as endophytes and produce microsclerotia is important to know. The goal of this project was to understand the lineage-specificity of the endophytic interactions of V. dahliae with asymptomatic rotational crops and weeds in potato fields. In this project, we wanted to identify not only lineages of the fungus that infect asymptomatic rotational crops, but also asymptomatic host species commonly grown in rotation with potatoes. This knowledge would provide growers and agriculture professionals a solid groundwork for designing more efficient and effective crop rotations for a sustainable management of Verticillium wilt of potato.

For the first objective of the project, reference genomes representing V. dahliae lineages 4A and 4B were generated by using de-novo whole genome sequencing at Beijing Genomics Institute (BGI, China). Several PCR-based marker candidates for the rapid detection and quantification of the fungal mass present in a sample were generated using a genomic comparison approach. For that, available reference genomes from other lineages of the pathogen were included and compared to the genomes representing the lineage of interest. Genomic regions containing coding sequences (i.e. sequences that code for genes) that were present in the reference genomes on the lineage of interest and not in other lineages of the fungus were used for the development of lineage-specific PCR markers. Available public databases were used to ensure that designed primers were specific to our target genomic region. For the second objective, we could not conduct field sampling due to logistic and time constrains but we collected V. dahliae-infected plant samples from grower’s fields submitted to the Penn State Plant Disease Clinic and through Robert Leiby, Agronomist at the Pennsylvanian Co-Operative Potato Growers. Plant samples were processed for DNA extraction and in future work, samples will be analyzed with the markers developed as part of this research to test if V. dahliae lineages 4A or 4B are infecting them. Preliminary results of this project and results from previous studies in our lab were presented at the 2019 Mid-Atlantic Fruit and Vegetable Convention in the Potato session. In the presentation, we emphasized the biology of V. dahliae, the epidemiological importance of the lineage of the pathogen, the diversity of asymptomatic rotational crop species and weeds that we have found infected with lineage 4B of the pathogen and the need to improve our current methods and tools for the detection and quantification of V. dahliae lineages, especially lineages 4A and 4B for potato growers in the US. Preliminary results were also presented at the Department of Plant Pathology and Environmental Microbiology, Penn State, and at the USDA-ARS Beltsville Agricultural Research Center, Beltsville, MD, for a scientific and academic audience.

Upon the completion of this project, these markers will provide agronomists, diagnosticians, research groups and agricultural services a tool to rapidly identify V. dahliae lineages 4A and 4B and quantify the levels of them present in any type of sample (plant, soil, microbial culture, etc.). This information is important for the decision-making process of Verticillium wilt management and eventually, will allow growers and seed producers to take preventative actions. It would help growers and agronomists use a more integrative disease management approach combining more sustainable strategies such as avoidance of highly-infested fields (especially in the case of V. dahliae lineage 4A), reject infected seed lots, longer crop rotations, etc. Marker 4B_23B constitute a tool to study pathogen and endophyte dynamics of V. dahliae lineage 4B and this is important since culture-based methodologies poses significant limitations. This marker would also facilitate the study of the effects of asymptomatic infections of rotational crops on the dynamics of V. dahliae soil inoculum. For a variety of reasons, current culture-based methodologies pose limitations to these types of research questions. A DNA-based method such as marker 4B_23B could provide a tool to monitor changes in the DNA levels of V.dahliae lineage 4B present in the field soil, plant root systems or infecting plant hosts. Specifically, the markers designed in this project could be used to investigate how inoculum levels from lineages 4A and 4B increase or decrease after a specific crop is over. Additionally, these DNA-based tools could become standard methodologies in diagnostic and quarantine services.

One challenge of these objectives was to identify lineage-specific markers that could encompass the entire diversity of the lineage having only genomic material representing one part of that diversity. Another challenge of this project has been to identify infected asymptomatic host plants in the field, especially those grown in rotation with potatoes. The fact that asymptomatic host plants do not show symptoms poses a great challenge for sampling them from commercial fields. Previous work in our lab using culture-based methodologies did not have a great success isolating the fungus after several hundreds of plant samples were collected from growers’ fields. However, the markers developed in this study could provide a more rapid and easy method to detect the fungus since microbial isolation is not needed and the detection is performed on the total DNA extracted from the plant sample.

Project Objectives:

In this project, we will address the following hypothesis that is based on preliminary research conducted by our group and existing peer-reviewed literature: Lineages of V. dahliae infect asymptomatic rotational crops and weeds in potato fields. These interactions allow the fungus to complete its life cycle, produce inoculum and shift the genetic diversity of V. dahliae populations present in the soil. The VCG diversity maintained by the asymptomatic hosts harbors potential to dictate the severity and incidence of the epidemic in the subsequent potato crops.
The main objectives of this project are to:

1. Develop VCG/lineage-specific PCR-based markers for V. dahliae lineages 4A and 4B to be used for detection in environmental samples such as fungal cultures, plant material and soil.

2. Identify which crop species used in rotation with potato are asymptomatically infected with V. dahliae and more specifically, which pathogen lineages infect them.

Introduction:

Verticillium dahliae is a soilborne fungal plant pathogen with a worldwide distribution, unknown sexual stage and that survives in the environment as microsclerotia or infecting mycelia (Rowe and Powelson 2002; Wilhelm 1955). It is the main causal agent of Verticillium wilt, a vascular disease that affects about 400 different plant species (Pegg and Brady 2002). In the case of potato, disease management is performed through soil disinfestation with soil fumigants because of the limited availability of resistant cultivars. In Northeast potato agroecosystems, chloropicrin and 1,3- dichloropropene are sometimes used to control Verticillium wilt and other soilborne pests. On the contrary, crop rotations with non-host species are a more sustainable and a more common management practice that is employed despite mixed results (Johnson and Dung 2010). The goal of crop rotations is to minimize inoculum build- up in soil by separating susceptible crops as much as possible through time. It is crucial to select rotational crops that are both not susceptible to the disease and non-hosts of the pathogen. However, crop rotations have often rendered conflicting results in Verticillium wilt incidence, severity and soil inoculum density indicating that inoculum of the pathogen probably is maintained (Busch et al. 1978; Davis et al. 1996,1999a,1999b). Some studies have reported not only V. dahliae asymptomatically infecting weeds and rotational crops such as oat, barley, and mustard species, but the formation of microsclerotia (i.e. survival fungal structures that serve as inoculum) on the host plant even though they may not be systemically colonized (Demirci and Genc 2011; Evans 1971; Evans and Gleeson 1973; Harrison and Isaac 1969; Lacy and Horner 1966). Previous work in our lab reported similar results from a case-study in a potato field located in Pennsylvania, where the fungus was isolated from asymptomatic oats being used as a rotational crop with potato (Malcolm et al. 2013).

Verticillium dahliae populations are highly clonal and traditional vegetative compatibility groups (VCGs) correlate with evolutionary clonal lineages of the fungus regardless of host or geographical origin of the fungal isolates (Milgroom et al. 2014; Rafiei et al. 2018a,2018b). In filamentous fungi, vegetative compatibility is the genetic ability of two isolates to undergo hyphal fusion and form a stable heterokaryon. Two fungal isolates of the same species are said to be vegetatively compatible when they share the same alleles at the het (heterokaryon incompatibility) loci (Leslie 1993; Leslie and Summerell 2006). VCGs and clonal lineages have been used as markers for population biology studies because variations in pathogenicity and virulence have been observed in isolates from different VCGs/lineages (Bhat et al. 2003; Dung et al. 2013; Hayes et al. 2011; Jimenez-Diaz et al. 2016). For instance, V. dahliae lineages 4A and 4B are two of the most commonly associated with potato agroecosystems. They also constitute the most important V. dahliae lineages affecting potato crops in the U.S. in terms of pathogenicity and virulence (Dung et al. 2013; Joaquim and Rowe 1991). Isolates of lineage 4A show higher aggressiveness to most commercial potato cultivars compared to isolates from lineage 4B (Joaquim and Rowe 1991; Omer et al. 2000). They can also interact synergistically with Pratylenchus penetrans nematodes when co- infecting potato plants which increases symptoms development and severity, resulting in significant tuber yield reduction (Botseas and Rowe 1994). Isolates of lineage 4B can infect and cause disease on potatoes. Recent work in our lab has also revealed that lineage 4B isolates were infecting asymptomatically numerous rotational crops and weeds recovered from Pennsylvania and Israeli potato fields affected by the disease (Malcolm et al. 2013; unpublished data). In fact, pathogenicity tests show that a same V. dahliae 4B isolate could infect and cause disease on potato ‘Snowden’ while infecting as an endophyte oat ‘Armor’ without visible disease symptoms (unpublished data). Current work would help understand how these endophytic infections (i.e. without causing disease symptoms) of V.dahliae lineage 4B affect management of the disease in subsequent potato crops. Specifically, it is important to elucidate if microsclerotia (inoculum) are produced in asymptomatic rotational crops, determine the levels and how they compare to the levels produced by the pathogen in susceptible crops. On the other hand, if lineage 4A isolates, highly aggressive to potato, are also able to infect rotational crops as endophytes and produce microsclerotia is important to know. This could seriously affect the dynamics of future epidemics by increasing levels of inoculum from highly aggressive lineages and increasing the incidence and severity of subsequent epidemics in potato crops.

Multiple molecular markers have been designed to identify and/or quantify V. dahliae isolates present in a wide range of environmental samples although all these markers cannot discriminate beyond the species level (Atallah et al. 2007; Bilodeau et al. 2012; Inderbitzin et al. 2013). Reliable molecular methods to identify VCGs or lineages of V. dahliae are still lacking and consequently, VCG or lineage identification needs to be carried out on pure cultures by either using the traditional VCG-typing method (Korolev et al. 2000), or genotyping-by-sequencing (GBS) (Elshire et al. 2011) or equivalent RADseq strategies (Andrews et al. 2016). The traditional VCG-typing method based on the use of nit mutants of the isolates is tedious, labor-intensive and limited by the slow growth of the fungus. Furthermore, results may vary depending on the isolates or experimental conditions used and some evolutionary lineages are difficult to type using culture-based methods (Ebihara et al. 1999; Fan et al. 2018; Milgroom et al. 2014). GBS and RADseq are methods that can lead to the precise identification of the lineage of an isolate by using a large number of SNPs randomly distributed in the genome of the isolate and lineage- representative individuals with the purpose of reconstructing the evolutionary history of the sample. However, factors such as enough population sample size, having V. dahliae lineage representatives, expensive sequencing costs and bioinformatics knowledge for data analysis may limit the use of these methods. The highly clonal structure of the species and the correlation of lineages with VCGs make it ideal for the development of VCG/lineage-specific PCR-based markers. The development of VCG/lineage-specific PCR-based markers will facilitate the study of the asymptomatic infections in rotational crops and weeds in potato fields for the purpose of helping growers make more informed management decisions.

The purpose of this project is to understand the VCG/lineage-specificity of the endophytic interactions of V. dahliae with asymptomatic rotational crops and weeds in potato fields. In this project, we will identify not only lineages of the fungus that infect asymptomatic rotational crops, but also asymptomatic host species commonly grown in rotation with potatoes. In addition, the VCG/lineage-specific molecular tools generated in this project will also serve as a diagnostic tool for detection of V. dahliae VCGs in plant material, seed tubers and soil samples and a tool for the quantification of inoculum in samples. As shown in previous studies, Verticillium dahliae lineages/VCGs are associated with meaningful biological information of the pathogen such as aggressiveness (Jimenez-Diaz et al. 2016). Some lineages/VCGs are significantly more aggressive to certain crops than others and can potentially cause higher economic losses to potato growers. Therefore, characterizing the lineage/VCG diversity present is important and would likely determine the strategies growers will take on the management of the disease. The knowledge generated under this project will provide growers and agriculture professionals a solid groundwork for designing more efficient and effective crop rotations, with the ultimate goal of reducing the use of soil fumigants and making management of Verticillium wilt of potato more sustainable.

In this project, we will focus on Verticillium wilt of potato although concepts, rationale and results can be adapted to Verticillium wilts affecting other crops. In fact, the conceptual framework here described can potentially be applied to the management of other soilborne pathogens.

Literature cited

Andrews, K. R., Good, J. M., Miller, M. R., Luikart, G., and Hohenlohe, P. A. 2016. Harnessing the power of RADseq for ecological and evolutionary genomics. Nature Reviews Genetics 17:81-92.

Atallah, Z. K., Bae, J., Jansky, S. H., Rouse, D. I., and Stevenson, W. R. 2007. Multiplex Real-Time Quantitative PCR to Detect and Quantify Verticillium dahliae Colonization in Potato Lines that Differ in Response to Verticillium Wilt. Phytopathology 97:865-72.

Bhat, R. G., Smith, R. F., Koike, S. T., Wu, B. M., and Subbarao, K. V. 2003. Characterization of Verticillium dahliae isolates and wilt epidemics of pepper. Plant Dis. 87:789-797.

Bilodeau, G. J., Koike, S. T., Uribe, P., and Martin, F. N. 2012. Development of an assay for rapid detection and quantification of Verticillium dahliae in soil. Phytopathology 102:331-343.

Botseas, D. D., and Rowe, R. C. 1994. Development of potato early dying in response to infection by two pathotypes of Verticillium dahliae and co-infection by Pratylenchus penetrans. Phytopathology 84:275-282.

Busch, L. V., Smith, E. A., and Njohelango F. 1978. Effect of weeds on value of rotation as a practical control for Verticillium wilt of potato. Can. Plant Dis. Surv. 58:61-64.

Davis, J. R., Huisman, O. C., Everson, D. O., Schneider, A. T., and Sorensen, L. H. 1999a. Suppression of Verticillium wilt with wheat and improved yield and quality of the Russet Burbank potato. Am. J. Potato Res. 76:367.

Davis, J. R., Huisman, O. C., Everson, D. O., Sorensen, L. H., and Schneider, A. T. 1999b. Control of Verticillium wilt of the Russet Burbank potato with corn and barley. Am. J. Potato Res 76:367.

Davis, J. R., Huisman, O. C., Westermann, D. T., Hafez, S. L., Everson, D. O., Sorensen, L. H., and Schneider, A. T. 1996. Effects of green manures on Verticillium wilt of potato. Phytopathology 86:444–453.

Demirci, E., and Genc, T. 2011. Vegetative compatibility groups of Verticillium dahliae isolates from weeds in potato fields. Erratum. J. Plant Pathol. 93:757.

Dung, J. K. S., Peever, T. L., and Johnson D. A. 2013. Verticillium dahliae populations from mint and potato are genetically divergent with predominant haplotypes. Phytopathology 103:445-459.

Easton, G. D., Nagle, M. E., and Seymour, M. D. 1992. Potato production and incidence of Verticillium dahliae following rotation to nonhost crops and soil fumigation in the State of Washington. Am. Potato J. 69:489-501.

Ebihara, Y., Nagao, H., Koike, M., Shiraishi, T. and Lijima, T. 1999. Vegetative compatibility relationships among weakly pathogenic isolates (pathotype E) of Verticillium dahliae. Mycoscience 40:41-49.

Elshire, R. J., Glaubitz, J. C., Sun, Q., Poland, J. A., Kawamoto, K., et al. 2011. A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. PLoS One 6:e19379.

Evans, G. 1971. Influence of weed hosts on the ecology of Verticillium dahliae in newly cultivated areas of the Namoi Valley, New South Wales. Ann. Appl. Biol., 67:169-175.

Evans, G., and Gleeson, A. C. 1973. Observations on the origin and nature of Verticillium dahliae colonizing plant roots. Aust. J. Biol. Sci. 26:151-161.

Fan, R., Cockerton, H. M., Armitage, A. D., Bates, H., Cascant-Lopez, E., Antanaviciute, L., Xu, X., Hu, X., and Harrison, R. J. 2018. Vegetative compatibility groups partition variation in the virulence of Verticillium dahliae on strawberry. PLoS One 13:e0191824.

Harrison, J. A. C., and Isaac, I. 1969. Survival of the causal agents of ‘Early dying disease’ (Verticillium Wilt) of potatoes. Ann. Appl. Biol. 63:277-288.

Hayes, R. J., Maruthachalam, K., Vallad, G. E., Klosterman, S. J., and Subbarao, K. V. 2011. Selection for resistance to Verticillium wilt caused by race 2 isolates of Verticillium dahliae in accessions of lettuce (Lactuca sativa L.). HortScience 46:201-206.

Inderbitzin, P., Davis, R. M., Bostock, R. M., Subbarao, K. V. 2013. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays. PLoS ONE 8(6):e65990.

Jiménez-Díaz, R. M., Olivares-García, C., Trapero-Casas, J. L., Jiménez-Gasco, M. M., Navas-Cortés, J. A., Landa., B. B., and Milgroom, M. G. 2016. Variation of pathotypes and races and their correlations with clonal lineages in Verticillium dahliae. Plant Pathology 66: 651–666.

Joaquim, T. R., and Rowe, R. C. 1991. Vegetative compatibility and virulence of strains of Verticillium dahliae from soil and potato plants. Phytopathology 81:552–558.

Johnson, D. A., and Dung, J. K. S. 2010. Verticillium wilt of potato: the pathogen, disease and management. Can. J. Plant Pathol. 32:58-67.

Korolev, N., Katan, J., and Katan, T. 2000. Vegetative compatibility groups of Verticillium dahliae in Israel: Their distribution and association with pathogenicity. Phytopathology 90:529-536.

Lacy, M. L., and Horner, C. E. 1966. Behaviour of Verticillium dahliae in the rhizosphere and on roots of plants susceptible, resistant, and immune to wilt. Phytopathology 56:427- 430.

Leslie, J. F. 1993. Fungal vegetative compatibility. Annu. Rev. Phytopathol. 31:127-150.

Leslie, J. F. and Summerell, B. A. 2006. The Fusarium Laboratory Manual. Blackwell Publishing. Ames, Iowa. U.S.

Malcolm, G. M., Kuldau, G. A., Gugino, B. K., and Jiménez-Gasco, M. M. 2013. Hidden host plant associations of soilborne fungal pathogens: An ecological perspective. Phytopathology 103:538-544.

Milgroom, M. G., Jiménez-Gasco, M. M., Olivares-García, C., Drott, M. T., and Jiménez-Díaz, R. M. 2014. Recombination between clonal lineages of the asexual fungus Verticillium dahliae detected by genotyping by sequencing. PLoS One 9: E106740.

Omer, M. A., Johnson, D. A., and Rowe, R. C. 2000. Recovery of Verticillium dahliae from North American certified seed potatoes and characterization of strains by vegetative compatibility and aggressiveness. Am. J. Potato Res. 77:325-331.

Pegg, G. F., and Brady, B. L. 2002. Verticillium Wilts. CABI Publishing. Wallingford. UK.

Rafiei, V., Banihashemi, Z., Bautista-Jalon, L. S., Jiménez-Gasco, M. M., Turgeon, B. G., and Milgroom, M. G. 2018a. Population genetics of Verticillium dahliae in Iran based on microsatellite and SNP markers. Phytopathology 108:780-788.

Rafiei, V., Banihashemi, Z., Jiménez-Díaz, R. M., Navas-Cortés, J. A., Landa, B. B., Jimenez-Gasco, M. M., Turgeon, B. G. and Milgroom, M. G. 2018b. Comparison of genotyping by sequencing and microsatellite markers for unravelling population structure in the clonal fungus Verticillium dahliae. Plant Pathology 67: 76-86.

Rowe, R. C., and Powelson, M. L. 2002. Potato early dying: Management challenges in a changing production environment. Plant Disease 86:1184– 1190.

Wilhelm, S. 1955. Longevity of the Verticillium wilt fungus in the laboratory and field. Phytopathology 45:387- 391.

Cooperators

Click linked name(s) to expand
  • Robert Leiby (Educator and Researcher)

Research

Materials and methods:

1.- Development of molecular detection protocols for V. dahliae lineages 4A and 4B.

The first objective of this project is to develop VCG/lineage-specific markers for molecular detection of V. dahliae 4A and 4B.

Verticillium dahliae isolates

Four isolates of V. dahliae representative of the lineages 4A and 4B were selected for whole genome sequencing. T003 and S-228 belong to V. dahliae lineage 4A and U073 and S-39 to lineage 4B. These individuals were recovered in potato fields from Pennsylvania and Ohio and were isolated from a naturally infected potato plant (T003), soil from potato fields (S-228 and S-39), and an asymptomatically-infected rotational oat cultivated in a potato field (U073) (Table 3). Pathogenicity of the isolates has been confirmed in previous works. These isolates are currently maintained in soil vials at the V. dahliae culture collection in Jimenez-Gasco’s lab, The Pennsylvania State University, University Park, PA.

Whole genome sequencing and assembly

Fungal mycelia were grown on cellophane film on petri plates filled with potato dextrose agar (PDA, Difco™, Franklin Lakes, NJ). Mycelia was harvested and freeze-dried, and around 5 grams of lyophilized tissue from each isolate were sent to Beijing Genomics Institute (BGI, Shenzhen, China) for whole genome sequencing.

Isolates T003 and U073 genomes were sequenced using a de-novo hybrid whole genome sequencing approach which involves a combination of PacBio long reads (Pacific Biosciences technology, Menlo Park, CA, US) and short paired-end reads using Illumina HiSeq 4000. PacBio long reads were trimmed, quality-filtered and assembled into scaffolds using Canu 1.7.1 (Koren et al. 2017). Illumina short reads were trimmed and quality-filtered using Trimmomatic 0.38 (Bolger et al. 2014). Trimmed short reads were aligned to the scaffold draft assembly with BWA 0.7.17 (Li 2013) mem option and default parameters for paired-end reads. Nucleotide errors in the draft scaffold assembly were corrected with the aligned short reads using Pilon 1.23 (Walker et al. 2014). Isolates S-39 and S-228 genomes were sequenced using only Illumina HiSeq 4000. Illumina short reads were trimmed and quality-filtered using Trimmomatic 0.38 and de-novo assembled into scaffolds using SPAdes 3.13 (Bankevich et al. 2012). Qualities of the assemblies were checked with Quast 5.0.2 (Mikheenko et al. 2018). Completeness of the genome assembly in terms of gene content was analyzed using de-novo gene prediction with GlimmerHMM (Majoros et al. 2004), and single-copy orthologue content with BUSCO using fungus and conserved-genes-finding options (Simão et al. 2015).

Development of V. dahliae lineage 4A and 4B molecular markers

Lineage-specific (LS) genomic regions for V. dahliae lineage 4A and 4B were identified by selecting genomic nucleotide sequences from isolates of lineage 4A (T003 and S-228) and lineage 4B (U073 and S-39) that were present only in the genome assemblies of their respective lineage and not in other V. dahliae lineages reference genome assemblies.

First, Illumina short reads from T003 and U073 were aligned to their respective genomes assemblies using BWA with mem option. Only mapped reads were then aligned to genome assemblies of V. dahliae lineage representatives 1A/B (Gwydir1A3 and Vd991), 2B824 (VdLs.17 and JR2), 2A (12161 and 12158), 4A (S-228) and 4B (S-39) using the same alignment algorithm (Table 2). Once lineage-specific reads were identified, these were de-novo assembled into longer fragments (i.e. scaffolds) using Spades with default options. Lineage-specific scaffolds were analyzed for: i) potential number of copies in their reference genomes by aligning them back using BWA mem; ii) presence of predicted genes or coding sequences (CDS) using GlimmerHMM in Quast; iii) presence of homologous gene sequences using a gene-annotated genome from Verticillium longisporum available as reference in WebAUGUSTUS prediction tool (Hoff and Stanke 2013); and (iv) presence of repetitive elements with the RepeatMasker Web Server selecting RMBlast as search engine, part of the NCBI Blast tool suite, and fungi DNA option (Smit 2013). For the design of PCR-based LS markers, we selected genomic nucleotide sequences that had the following conditions: i) they only aligned to one position in the genome assemblies of their respective lineage, and did not have insertions, deletions or significant nucleotide mismatches; ii) they have a CDS and was not homologous to CDSs from V. longisporum; and iii) did not have repetitive elements.

Second, PCR-based LS markers were designed using Primer-BLAST web tool selecting a range of 80-150 bp for PCR product size, and a 57º C minimum, 60º C optimum and 63º C maximum primer melting temperatures. Organism specificity of the primers was ensured using the nucleotide reference database and delimiting the organisms to bacteria, fungi and oomycete. For each LS coding genomic sequence, we selected the primer pairs with the best characteristics for PCR and Quantitative-PCR (Q-PCR) reactions, which are: i) primer sizes with 18-22 nucleotides; ii) GC nucleotide content between 50-60%; iii) having a G or C nucleotide in the last 5 bases of the primer; iv) not having repeats of 4 or more adjacent identical nucleotides in the primer sequence; and v) the lowest scores for self-complementarity and self 3’-complementarity. Annealing temperatures (Ta) of the primers were estimated using the New England Biolabs Tm Calculator (New England Biolabs, Ipswich, MA) and some primer pairs were initially tested on DNA samples from V. dahliae lineages 4A and 4B using the estimated Ta (Table 1 and 2). The conditions of the PCR reaction for the selected pairs of primers were optimized using a gradient of annealing temperatures ranging from 54º C to 64º C and DNA samples from T003 isolate (V. dahliae lineage 4A) and U073 isolate (V. dahliae lineage 4B) respectively. PCR reaction mixtures (25 μl) consisted of 5-10 ng of fungal DNA template, 400 nM of each primer and 12.5 μl OneTaq® 2X Master Mix with Standard Buffer (New England BioLabs, Ipswich, MA). Conditions of the PCR reactions included an initial denaturation at 96°C for 4 min, followed by 35 cycles of denaturation at 96°C for 1 min, annealing at corresponding temperature for 30 s, elongation at 72°C for 1 min, and a final elongation step at 72°C for 6 min.

Primer pairs were tested on a range of DNAs obtained from representatives of the different evolutionary clades from V. dahliae lineages 4A and 4B using the optimized PCR conditions of each marker (Table 1). In addition, primers were also tested on DNA from V. dahliae representatives of lineages 1A/B, 2A, 2B824, 2B334, 3 and 6 to analyze their lineage-specificity amplifications (Table 3).

Quantification of V. dahliae lineages 4A and 4B in environmental samples

A protocol to quantify the amount of V. dahliae lineage 4A and 4B DNAs present in samples was developed at Wright Lab (Huntingdon, PA) using the PCR-based markers designed in this study. Digital Droplet PCR (ddPCR) is a precise method to quantify absolute amounts of nucleic acids without a standard curve and without dependence on amplification efficiency. The ddPCR is a relatively new technology but provides fast and more robust detection and quantification methods than previous technologies such as Real-Time Quantitative-PCR. The ddPCR protocol for lineage 4A and 4B markers was tested on DNA extracted from field soil samples infested with T003 isolate (V. dahliae lineage 4A) and U073 isolate (V. dahliae lineage 4B). Those field soil samples were collected from our research microplots at the Russell E. Larson Agricultural Research Center, The Pennsylvania State University. As part of a separate on-going experiment, the research microplots soil was infested with different V. dahliae treatments: T003 isolate (V. dahliae lineage 4A), U073 isolate (V. dahliae lineage 4B) and mixes at different ratios of both isolates (50:50, 20:80, and 80:20). Each set of microplots were cultivated with a monoculture of potato ‘Snowden’ (highly susceptible to Verticillium wilt), a monoculture of oat ‘Armor’ (an asymptomatic host) and a rotation of both.

 

Briefly, DNA from soil samples was extracted using ZymoBiomics DNA/RNA mini prep (Zymo Research) following manufacturer’s instructions. Samples without soil input were also extracted to serve as extraction controls (negative controls for ddPCR). DNA sample extracts were then quantified with Qubit 1X dsDNA high sensitivity assay on a Qubit 4 (Thermo Fisher) before being stored at -20 C until ddPCR set up. During set up, samples were normalized into a 96 well plate for ddPCR to a mass of 25 ng of DNA per sample and a master mix containing respective primer pairs (sequences below) of forward and reverse primers (final concentration: 0.25 µM forward, 0.1 µM reverse) were combined with EvaGreen Supermix (Biorad) was made for each primer set. The master mix was then added to the normalized sample wells and adjusted with nuclease free water to a final volume of 22 µL. Negative controls from extraction had 11 µL of extraction blank eluant added and no template controls of RT-grade PCR water were included following samples. Droplets were then generated on an Automated Droplet Generator (BioRad) and underwent PCR following EvaGreen reaction conditions as follows: Enzyme activation at 95 C for 5 minutes; followed by 40 cycles of 95 C for 30 s, then annealing and extension at 60 C for 60 s; followed by a 4 C hold for 5 minutes, then signal stabilization at 90 C for 5 minutes, before holding at 4 C until droplet reading. Once PCR was complete, droplets were read on a QX200 Droplet reader and resulting copies/µL and copies/20 µL reaction generated via QuantaSoft (Biorad).

 

  1. Identify which crops species used in rotation with potato are asymptomatically infected with V. dahliae and more specifically, which pathogen VCGs/lineages (4A, 4B) infect them.

The second objective of this project is to detect V. dahliae lineages infecting plant species cultivated under rotation in potato fields, and moreover, to identify which plant species get infected by which lineage/VCG. This is quite important since different lineages/VCGs show different aggressiveness to different plant hosts and therefore, they pose different threats to the sustainability of the disease management strategy. V. dahliae-infected plant samples have been collected through Robert Leiby, PA Co-Operative Potato Growers, and Dr. Sara May, director of the Penn State Plant Disease Clinic. Samples included different cultivars of potato, pepper and watermelon grown in commercial production fields in PA. Plant samples were washed with tap water. Stem tissues were finely sliced and lyophilized for further DNA extraction. Currently, more than 25 plant samples have been collected from about 5 farmers from different locations in PA. During summer 2018, weather conditions in PA were not conducive for Verticillium wilt and there were no reported symptomatic thus limiting our sample collection. Therefore, that limited our sample collection in that season. DNA of the plant samples will be extracted using DNeasy Plant mini kit (Qiagen, Hilden, Germany).

Literature cited

Bankevich, A., Nurk, S., Antipov, D., Gurevich, A., Dvorkin, M., Kulikov, A. S., Lesin, V., Nikolenko, S. I., Pham, S., Prjibelski, A. D., Pyshkin, A., Sirotkin, A. V., Vyahhi, N., Tesler, G., Alekseyev, M. A., and Pevzner, P.A. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19(5):455–77. pmid:22506599

Bhat, R. G., Smith, R. F., Koike, S. T., Wu, B. M., and Subbarao, K. V. 2003. Characterization of Verticillium dahliae isolates and wilt epidemics of pepper. Plant Dis. 87:789-797. 


Bolger, A. M., Lohse, M., and Usadel, B. 2014. Trimmomatic: A flexible trimmer for Illumina Sequence Data. Bioinformatics 30:2114-20.

Collado-Romero, M., Mercado-Blanco, J., Olivares-García, C., Valverde-Corredor, A., and Jiménez-Díaz, R. M. 2006. Molecular variability within and among Verticillium dahliae vegetative compatibility groups determined by fluorescent amplified fragment length polymorphism and polymerase chain reaction markers. Phytopathology 96:485-495. 


Collins, A., Mercado‐Blanco, J., Jiménez‐Díaz, R. M., Olivares, C., Clewes, E., Barbara, D. J. 2005. Correlation of molecular markers and biological properties in Verticillium dahliae and the possible origins of some isolates. Plant Pathology 54: 549-557

Hoff, K. J., and Stanke, M. 2013. WebAUGUSTUS – a web service for training AUGUSTUS and predicting genes in eukaryotes. Nucleic Acids Res, doi:10.1093/nar/gkt418

Joaquim, T. R., and Rowe, R. C. 1990. Reassessment of vegetative compatibility relationships among strains of Verticillium dahliae using nitrate non-utilizing mutants. Phytopathology 80:1160-1166.

Joaquim, T. R., and Rowe, R. C. 1991. Vegetative compatibility and virulence of strains of Verticillium dahliae from soil and potato plants. Phytopathology 81:552–558

Koren S, Walenz BP, Berlin K, Miller JR, Phillippy AM. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome Research 27:722-736.

Li, H. 2013. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv:1303.3997.

Majoros, W.H., Pertea, M., and Salzberg, S.L. 2004. TigrScan and GlimmerHMM: two open-source ab initio eukaryotic gene-finders. Bioinformatics 20:2878-2879

Mikheenko, A., Prjibelski, A., Saveliev, V., Antipov, D., Gurevich, A. 2018. Versatile genome assembly evaluation with QUAST-LG. Bioinformatics 34:142-150.

Omer, M. A., Johnson, D. A., and Rowe, R. C. 2000. Recovery of Verticillium dahliae from North American certified seed potatoes and characterization of strains by vegetative compatibility and aggressiveness. Am. J. Potato Res. 77:325-331.

Simão, F. A., Waterhouse, R. M., Ioannidis, P., Kriventseva, E. V., and Zdobnov, E. M. 2015. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. doi:10.1093/bioinformatics/btv351

Smit, A. F. A., Hubley, R. and Green, P. 2013. RepeatMasker Open-4.0. 2013-2015. http://www.repeatmasker.org.

Walker, B. J., Abeel, T., Shea, T., Priest, M., Abouelliel, A., Sakthikumar, S., Cuomo, C. A., Zeng, Q., Wortman, J., Young, S. K., Earl, A. M. 2014. Pilon: An Integrated Tool for Comprehensive Microbial Variant Detection and Genome Assembly Improvement. PLoS One 9:e112963.

 

Workshops and training performed

Since 2017, I have taken several workshops to train myself in the type of analysis I need to perform in my objectives. I plan to share my knowledge with other students through workshops so they can apply as well in their research:

  • Whole genome sequence analysis workshop by Jasna Kovac. The Microbiome Center, The Pennsylvania State University, University Park, PA. November 2, 2018.
  • Launching the Agricultural Microbiomes Research Coordination Network. Agricultural Microbiomes Research Coordination Network. International Congress for Plant Pathology (ICPP) 2018. Boston, MA. July 28, 2018.
  • Biological Data Analysis: The Right Way, The Second Boot Camp on Data Reproducibility by NIH funded Computation, Bioinformatics and Statistics (CBIOS) Predoctoral Training Program. The Pennsylvania State University, University Park, PA. July 10-14, 2017.
  • Genome Assembly workshop by Qi Sun. Institute of Biotechnology, Cornell University, Ithaca, NY. May 24-31, 2017.

 

 

Research results and discussion:

1.- Development of molecular detection protocols for V. dahliae lineages 4A and 4B.

Verticillium dahliae lineage 4A and 4B genomes sequencing and assembly

The genome of T003 was assembled with a total of 939,794 PacBio reads and 182.35 X sequencing coverage. The length of T003 PacBio reads ranged from 1,000 to 23,000 bp. Pilon repaired a total of 1,124 nucleotide errors using 150-bp paired-end reads from T003. T003 genome assembly consisted in 52 scaffolds with 35.56 Mbp total length. Twenty-one of the scaffolds summed 35.15 Mbp of the total genome length. The largest scaffold was 4.05 Mbp, L50 was 5 and N50 was 2.87 Mbp, and 53.83% GC content. BUSCO estimated that 99.66% of the ortholog conserved genes found in the assembly were completed as full genes using the fungus database. The number of de-novo unique genes predicted by GlimmerHMM was 29,033. The U073 genome was assembled with a total of 1,094,947 PacBio reads and 174.44 X sequencing coverage. The length of PacBio reads ranged from 1,000 to 19,000 bp. Pilon corrected 1,544 nucleotide errors in U073 genome assembly. The U073 genome assembly consisted in 89 scaffolds with 36.08 Mbp total length. Thirty-five of the scaffolds summed 35.58 Mbp of the total genome length. The largest scaffold was 4.92 Mbp, L50 was 7, N50 was 1.69 Mbp and 53.76% GC content. BUSCO results using the fungus database estimated that 99.66% of ortholog genes found were completed as full genes and 0.34% were partial in the assembly. GlimmerHMM predicted a total of 28,800 genes present in the assembly.

The assembly of the S-39 genome was performed using a total of 32,876,450 150-bp paired-end reads and a 142.16 X sequencing coverage. The final assembly had 474 scaffolds and a total length of 34.69 Mbp with the largest scaffold 2.05 Mbp long. GC content was 53.87%, L50 was 13 and N50 was 623,094 bp. Completeness based on BUSCO ortholog databases is 99.66% and GlimmerHMM estimated 28,237 genes present in the assembly. The S-228 genome assembly was carried out with 32,863,500 total paired-end reads of 150 bp length and 140.72 X sequencing coverage. The assembly constituted of 1,565 scaffolds and a total length of 35.03 Mbp with the largest scaffold being 3.27 Mbp long. GC content 54.09%, L50 is 11, N50 is 964,404 bp. Genome completeness results from BUSCO provided the same percentages as the other genome assemblies and GlimmerHMM predicted 28,508 genes in the assembly.

V. dahliae 4A and 4B lineage-specific PCR-based markers

A total of 34,278 paired-end reads from lineage 4A isolate T003 failed to align to the reference genomes of V. dahliae lineages other than 4A T003 and S-228. Similarly, a total of 28,841 paired-end reads from lineage 4B isolate U073 were found to be present only in V. dahliae lineage 4B isolates U073 and S-39. Paired-end reads specific to lineage 4A (i.e. they align only to V. dahliae lineage 4A genomes) were assembled into 82 scaffolds that ranged from 14,305 to 78 bp length and had a 104,509 bp total length. In the case of lineage 4B, lineage-specific reads were assembled into 98 scaffolds that ranged in length sizes from 9,630 to 83 bp and had a total length of 101,265 bp.

Among lineage 4A-specific scaffolds, GlimerHMM found 88 coding sequences (CDS) in 35 of the 82 total scaffolds. RepeatMarker identified 19 simple repeats elements (microsatellite sequences), 2 regions containing ribosomal RNA sequences, one LINE/CR1 transposon element, and 3 low complexity elements that consisted in sequences rich in A nucleotide. AUGUSTUS found 16 genes that were homologous to V. longisporum gene sequences. For the development of PCR-based lineage 4A-specific markers, primer pairs were designed in CDSs located in scaffolds 2, 8, 23, 25, 30 and 31 (Table 2). Using the estimated Ta, we tested primer pairs for markers 4A_2128, 4A_8, 4A_25 and 4A_239, 4A_30 and 4A_31 on a range of DNAs from lineage 4A clades 1, 2 and 3 (Table 3). All DNA samples from lineage 4A clades provided the specific amplified product size (95 bp) for marker 4A_30 using the estimated Ta while DNAs from clade 1 did not amplify markers 4A_2-2128, 4A_8, 4A_25, 4A_2-239 and 4A_31. Annealing temperature was optimized at 60º C for marker 4A_30 using a gradient function and DNA samples from all lineage 4A clades amplified the expected 95-bp product with the optimized Ta (Fig. 1). Marker 4A_30 was tested on DNA samples representing the known diversity of V. dahliae and DNAs from lineage 4A provided the expected PCR amplification. However, some weak amplifications were observed when using 1.5% agarose gel electrophoresis that were not visible in the 1% agarose gel method. Current work is ongoing to find another marker with improved specificity for lineage 4A.

Comparatively, there were 21 simple repeat elements such as microsatellite sequences and 2 sequences that encoded transfer RNA among 4B-specific scaffolds. GlimmerHMM found 45 CDS across 26 scaffolds of the total 98 lineage 4B-specific scaffolds. AUGUSTUS found 13 gene sequences that were homologous to V. longisporum gene sequences. Based on these results, primer pairs for lineage 4B-specific markers were designed in scaffolds 9, 17 and 23. We tested primer pairs 4B_9B, 4B_17A, 4B_17B and 4B_23B using the estimated annealing temperatures (Table 1) and a range of DNA samples from the different lineage 4B clades (Table 3). In all cases, DNA samples provided the specific amplicon of the respective marker except for the case of lineage 4B clade 3 samples, T006 and U120, which showed a pattern of random amplified products varying in sizes. Therefore, lineage 4B clade 3 was discarded from further experiments. Conditions of the PCR reactions were optimized for primer pairs 4B_17A and 4B_23B and optimum Ta were set at 60º C based on the gradient results using DNA from U073 isolate. The PCR reactions at 60º C Ta yielded the expected 91-bp amplicon product for marker 4B_23B on DNA samples from lineage 4B clade 1, and clade 2 and was concordant with PCR reactions using the estimated Ta (Fig. 1). Similarly, the PCR reaction with 4B_17A marker using the optimized Ta yielded an 86-bp amplicon on DNA samples from clades 1 and 2 (Fig. 1). Marker 4B_23B was tested on DNA samples representing the known diversity of V. dahliae as well and only lineage 4B DNAs tested positive in the PCR reaction which makes 4B_23B marker selective for V. dahliae lineage 4B individuals (Fig. 2).

Quantification of V. dahliae lineages 4A and 4B in environmental samples

Preliminary results from the ddPCR reactions showed that marker 4B_23B was able to detect and quantify levels of DNA from V. dahliae lineage 4B in 5 of the 30 soil samples infested with lineage 4B isolate U073. Current efforts are directed towards testing more samples from other replicates of the experiments and evaluate the accuracy and limit of the detection.

On the contrary, reactions using marker 4A_30 detected and quantified DNA levels of V. dahliae lineage 4A in soil samples infested with lineage 4A isolate T003, but also on soil samples with only lineage 4B. Current work is focused on troubleshooting this and improving details of the reaction protocol to avoid having false positives. Some of things we are currently working on are finding other markers from Table 2 that select only for lineage 4A samples, and improving the temperatures of the reactions to increase specificity and sensitivity of the marker when using DNA from environmental samples.

 

  1. Identify which crops species used in rotation with potato are asymptomatically infected with V. dahliae and more specifically, which pathogen VCGs/lineages (4A, 4B) infect them.

Preliminary work in our lab showed that common rotational crops and weed species were asymptomatically infected by V. dahliae lineage 4B in Pennsylvania and Israeli potato fields affected by the disease. Infected rotational crops included sorghum, oats and soybean. Weed species infected asymptomatically by lineage 4B of the pathogen were amaranth species, wild mustard species, wild Solanum spp., Malva parviflora, and other Boraginaceae and Brassicaceae species. Other V. dahliae-infected plant samples collected through the PA Potato Co-Op and the Plant Clinic at Penn State included different potato cultivars, oat, pepper and watermelon. They are kept lyophilized in sterile tubes. Once the detection and quantification protocol using ddPCR is optimized, DNA from these infected plant samples will be extracted and tested using 4A_30 and 4B_23B markers. We expect to have a positive PCR amplification along with some concentration levels if V. dahliae lineage 4A or 4B happen to be infecting these plant samples.

Table 1 Verticillium dahliae lineage 4B PCR-based markers designed in this study.

Marker

Scaffolda

Start and end nucleotide position

Primer sequences (5’ to 3’)

Tm (ºC)b

Amplicon length (bp)

Calculated Ta (ºC)c

4B_9A

NODE_9

855 – 955

F:CATCGCCTTCACCGACTACA

59.83

101

56

 

 

 

R:CCGGGGCACACTTCTAACAT

60.04

 

 

4B_9B

NODE_9

1948 – 2060

F:ACATGAGAGGCGTACAACGG

60.11

113

56

 

 

 

R:GCACTGCATGACGGAACAAG

60.11

 

 

4B_17A

NODE_17

359 – 444

F:TACGTCGAGAGCAAAGTGGC

60.39

86

56

 

 

 

R:GAAGCATCCAGCCGGGTATT

60.18

 

 

4B_17B

NODE_17

478 – 592

F:GGTCGTATTCCGGGTCATGC

60.88

115

56

 

 

 

R:GTCTTTCAGGTGAAGGCCCA

59.89

 

 

4B_23A

NODE_23

234 – 325

F:GCAATCTTCCAGACGCCCTA

59.82

92

56

 

 

 

R:GATTCTCTGGCAAATGCGGG

59.62

 

 

4B_23B

NODE_23

269 – 359

F:CCGATACTCGGGACCAAACA

59.47

91

56

 

 

 

R:GGCGGTCACTTTGGGTTTTC

59.97

 

 

 

a Scaffold from the U073 draft genome assembled in this study.

b Melting temperature of the primer.

c Estimated annealing temperature for the pair of primers in the PCR reaction.

 

Table 2 Verticillium dahliae lineage 4A PCR-based markers designed in this study.

Marker

Scaffolda

Start and end nucleotide position

Primer sequences (5’ to 3’)

Tm (ºC)b

Amplicon length (bp)

Calculated Ta (ºC)c

4A_2-239

NODE_2

36 – 147

F:ACTCTCCGCTTCCCATGACAGA

63.14

112

57

 

 

 

R:ATCCTTCTGATTGCGGGCTTG

61.02

 

 

4A_2-2128

NODE_2

6 – 112

F:GCGATTATGGACCGCAAGAGAT

60.54

107

56

 

 

 

R:AAGCATTTAGTCTCGCCCCGC

60.46

 

 

4A_2-2626

NODE_2

1354 – 1488

F:ATGTCTGGCACCCGAGGAAA

61.49

135

58

 

 

 

R:CCTGATAGAGCCACCATGCGA

61.98

 

 

4A_2-8080

NODE_2

179 – 281

F:TACACGCAGTTTTGGAGCCC

60.89

103

57

 

 

 

R:TCTGGTGTCTCTGGGTCTGC

61.19

 

 

4A_8

NODE_8

5 – 98

F:CCTGCACTAGCAAAGCCAAG

59.48

94

56

 

 

 

R:CTATCGGCGTCCCACTCTAC

59.41

 

 

4A_23

NODE_23

2 – 136

F:TGGCGAAGACGCATGAGGTT

62.45

135

59

 

 

 

R:GGGATGTGGAGTGGCGTAGT

61.61

 

 

4A_25

NODE_25

6 – 105

F:GCGTTGGTCACGACAGAAGAA

61.13

100

57

 

 

 

R:ATCGAGAGCCAGGCAAGACT

60.98

 

 

4A_30

NODE_30

57 – 151

F:GGTACAACAGGCGGTCAACAC

61.73

95

57

 

 

 

R:TAGCGTATTGCTCGGTTGCC

60.81

 

 

4A_31

NODE_31

26 – 125

F:CTCGGGCTGCTACTTGGTTT

60.32

100

57

 

 

 

R:GGACACCTGGTTGGATGCTT

60.25

 

 

 

a Scaffold from the T003 draft genome assembled in this study.

b Melting temperature of the primer.

c Estimated annealing temperature for the pair of primers in the PCR reaction.

 

Table 3 Information of Verticillium dahliae isolates included in this study.

Isolate

Source

Symptomatology

Year

Geographic origin

Lineage

Reference

V-830

Cotton

Symptomatic

2002

Jaen, Spain

1A

Collado-Romero et al. 2006

T9

Cotton

Symptomatic

pre-1983

Texas, US

1A

Joaquim and Rowe 1990

V-508

Tomato

Symptomatic

1996

Ohed, Israel

2A

Collins et al. 2005

V-404

Artichoke

Symptomatic

1999

Valencia, Spain

2A

Collado-Romero et al. 2006

V-685

Artichoke

Symptomatic

2002

Valencia, Spain

2B334

Collado-Romero et al. 2006

V-675

Artichoke

Symptomatic

2002

Valencia, Spain

2B334

Collado-Romero et al. 2006

V-645

Cotton

Symptomatic

2001

Greece

2B824

Collado-Romero et al. 2006

V-302

Cotton

Symptomatic

1995

Israel

2B824

Collins et al. 2005

PCW

Pepper

Symptomatic

pre-1983

California, US

3

Joaquim and Rowe 1990

VA-5

Potato

Symptomatic

1989

North Dakota, US

4A

R. Rowe

S-228

Field soil

 

1984

Ohio, US

4A

Joaquim and Rowe 1991

T003

Potato ‘Reba’

Symptomatic

2010

Ringtown, PA, US

4A

Jimenez-Gasco, M. M.

G055

Potato ‘Snowden’

Symptomatic

2010

Ringtown, PA, US

4A

Jimenez-Gasco, M. M.

G059

Potato ‘Snowden’

Symptomatic

2010

Ringtown, PA, US

4A

Jimenez-Gasco, M. M.

PA2

Potato

Symptomatic

2015

Sacramento, PA, US

4A

Jimenez-Gasco, M. M.

W90

Seed tuber ‘Norkotah’

Symptomatic

1995

South Dakota, US

4A

Omer et al. 2000

V186 (V-1-86)

Potato

Symptomatic

pre-1989

New York, US

4B

R. Rowe

V-557

Tomato

Symptomatic

1998

Brazil

4B

Collins et al. 2005

S-39

Field soil

 

1984

Ohio, US

4B

Joaquim and Rowe 1991

U073

Oat

Asymptomatic

2010

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

U120

Oat

Asymptomatic

2010

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

CB5

Potato

Symptomatic

2013

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

CB25

Potato

Symptomatic

2013

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

CB7

Potato

Symptomatic

2013

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

CB12

Potato

Symptomatic

2013

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

CB27

Potato

Symptomatic

2013

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

CB11

Potato

Symptomatic

2013

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

CB17

Potato

Symptomatic

2013

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

T006

Potato ‘Reba’

Symptomatic

2010

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

B46

Soybean

Asymptomatic

2015

Ringtown, PA, US

4B

Jimenez-Gasco, M. M.

PR6

Dandelion

Asymptomatic

2015

Sacramento, PA, US

4B

Jimenez-Gasco, M. M.

V-560 (VdCa.83)

Chili pepper

Symptomatic

1997

California, US

6

Bhat et al. 2003

V-561 (VdCa.147)

Chili pepper

Symptomatic

1997

California, US

6

Bhat et al. 2003

figure2figure1

Research conclusions:

These markers will provide agronomists, diagnosticians, research groups and agricultural services a tool to rapidly identify V. dahliae lineages 4A and 4B and quantify the levels of these specific lineages present in any type of sample (plant, soil, microbial culture, etc.). These results can then be used for making more informed research-based Verticillium wilt management which is important given the limited number of management tools. For instance, V. dahliae lineage 4A individuals are highly aggressive to most commercial potato cultivars so if present at high levels it may be cost effective to use a more expensive management tool such as fumigation. Markers to detect lineage 4A could provide a tool to monitor levels of V. dahliae lineage 4A in commercial fields or seed lots across time. Eventually, this would allow growers and seed producers to take actions in advance and use a more integrative disease management approach combining more sustainable strategies such as avoidance of infested fields, discard of infected seed lots, longer rotation sequences of crops, etc.

Marker 4B_23B presents a tool to study pathogen and endophyte dynamics of V. dahliae lineage 4B individuals. Previous research in our lab showed that V. dahliae lineage 4B individuals can infect asymptomatic rotational crops such as oats and infect and cause disease in potato crops. Therefore, this marker could provide a tool to rapidly test if an asymptomatic sample from a rotational crop is infected by lineage 4B of the pathogen. This tool can be used by researchers to identify true non-host rotational crops which in turn will help farmers select more effective rotational crops for preventing or reducing inoculum build-up of V. dahliae lineage 4B. As mentioned, individuals of this lineage are pathogenic to potatoes although they show lower virulence (less aggressive) than lineage 4A individuals. It is important to monitor levels of lineage 4B present in field soil and harbored by asymptomatic reservoirs (rotational crops) since disease caused by 4B individuals still produce important economic and yield losses in potato crops.

Overall, the main challenge of this research was to identify lineage-specific markers that could encompass the entire diversity of the lineage having only genomic material representing one part of that diversity. We did not have a complete picture of the diversity of the lineage available by the time we selected the candidate isolates for whole-genome sequencing. Not having genome references representing part of the diversity of a lineage provided some challenges to identify a marker that could detect all the diversity when used. In fact, it leaves a big part of the process depending on luck as well as trial and error. In the future, sequencing the genome of isolates representing the entire known diversity of the lineage could help develop more durable lineage-specific molecular markers. In addition, only reference genomes from few lineages of the fungus are available which made our work initially rely on testing the specificity of the markers on DNA samples through PCR. Overall, 4B_23B marker resulted to be selective for V. dahliae lineage 4B and ongoing efforts are working on developing an accurate quantification protocol using ddPCR technology.

Participation Summary

Education & Outreach Activities and Participation Summary

1 Consultations
3 Webinars / talks / presentations
4 Workshop field days

Participation Summary

25 Farmers
40 Number of agricultural educator or service providers reached through education and outreach activities
Education/outreach description:

As part of the outreach and education, I have presented several talks related to my current work at different occasions:

  • Bautista-Jalon, L.S., “Verticillium wilt of potato caused by Verticillium dahliae: a soilborne pathogen that hides as an endophyte”. USDA-ARS Beltsville Agricultural Research Center, Beltsville, MD. June 6, 2019.  Bautista_USDA_June2019
  • Bautista-Jalon, L.S., “Verticillium wilt of Potato: Can we manage the disease without soil fumigants?”, Mid-Atlantic Fruit and Vegetable Convention – Potatoes session. Hershey, PA. January 31, 2019.  Bautista_Verticillium_Jan2019-1
  • Bautista-Jalon, L.S., “To Be Host or Not to Be: The Role of Asymptomatic Hosts in the Management of Verticillium Wilt of Potato”, Department of Plant Pathology and Environmental Microbiology, The Pennsylvania State University, University Park, PA. April 16, 2018.  Bautista_April2018_seminar

Project Outcomes

6 Farmers reporting change in knowledge, attitudes, skills and/or awareness
2 Grants applied for that built upon this project
Project outcomes:

This has been discussed in the Research Conclusions section.

Knowledge Gained:

Overall, this project has allowed a deeper understanding on the way Verticillium wilts epidemics are managed in US potato agroecosystems. US potato growers have been often using crop rotations to manage soilborne diseases, and soil fumigation with chemicals when the epidemics were severe and produced significant economic losses in the potato crops. Working with growers has provided the opportunity to learn the difficulties and struggles in the management of this disease, especially when highly-aggressive lineages of the pathogen are present in the field. Some research teams are investigating more sustainable soil disinfestation methods that could avoid the use of chemical soil fumigants. We think that research on Verticillium wilt of potato has been moving towards finding more sustainable strategies and integrating knowledge advances in this pathosystem. More research is needed on many aspect of V. dahliae populations but we hope that our advances will contribute to create more sustainable agricultural ecosystems.

Assessment of Project Approach and Areas of Further Study:

Some of the challenges of the project have been discussed in the Research Conclusion section. Another challenge of this project has been to identify infected asymptomatic host plants in the field, especially those grown in rotation with potatoes. The fact that asymptomatic host plants do not show symptoms poses a great challenge to identify and collect samples from commercial fields for further studies. In the summer 2015, we collected around 350 asymptomatic plants of rye, timothy, oats, wheat, corn, soybean, sudangrass and several weed species which were growing in six different commercial PA potato fields which had a history of Verticillium wilt. We performed microbial isolation and characterization using traditional culture-based techniques. Unfortunately, we were able to recover the fungus from one soybean plant and one dandelion plant from the total of 350 plants collected. The markers developed in this study will provide a more rapid and easy method to detect the fungus since microbial isolation is not needed and the detection is performed on the total DNA extracted from the plant sample. However, there is also the risk of extracting DNA from a section of the plant where the fungus may not be located and therefore, provide a false negative. Different experimental approaches can be used to overcome these limitations and need to be taken into consideration when working on this subject.

Any opinions, findings, conclusions, or recommendations expressed in this publication are those of the author(s) and do not necessarily reflect the view of the U.S. Department of Agriculture or SARE.