Final report for GNE16-115
Project Information
Fire blight (Erwinia amylovora) is a devastating bacterial disease of apple, causing severe damage and economic loss in the Northeast United States, where over 20% of the nation’s apples are produced. To date, growers depend on streptomycin applications to control the disease, but this method is not sustainable due to occurrences of, and continued risk for, antibiotic resistance. Though insects have long been implicated as fire blight vectors, the potential benefits of controlling vectors as part of a fire blight management program are unknown. The purpose of this project is to advance our understanding of fire blight-insect interactions to identify new avenues for sustainable disease management.
Reports dating to the early 1900s suggest dipterans (flies), hymenopterans (bees), and hemipterans (leafhoppers) all play a role in transmitting fire blight to new hosts, but minimal data regarding how exactly these insects transmit E. amylovora are available. Further, all accounts suggest that no one insect is solely responsible for all fire blight transmission, rather insects as a collective play a role in its movement. Our investigative approach is threefold; 1) to identify insects that carry fire blight in the field; 2) to study the in-depth mechanisms of how these insects acquire and transmit the bacteria; and 3) to identify molecular and behavioral interactions between the insect and E. amylovora that could be targeted for management.
This project has established that Dipterans are key players in Erwinia amylovora epidemiology. We show that flies can acquire the bacteria from ooze, feed on ooze for extended periods of time, and the bacteria can persist in/on the insect for extended periods of time. We do not know where the bacteria localizes in/on the insect or how efficient the insect is at transmitting the bacteria. These processes are ecologically dynamic, and require innovative approaches to manage effectively. Future research will focus on understanding the final stages of transmission and what potential management strategies should be tested and applied to this system. While the outcomes from this research are more geared towards understanding the basic ecology and interactions within the system, we have laid the foundation to develop an environmentally sustainable and cost effect management strategy in the future.
Objective 1: Identify candidate insect vectors of E. amylovora.
Description: Existing data on insect transmission of fire blight is outdated and characterizes the vectoring process as passive. We predict that certain insects actively vector fire blight by transporting the pathogen internally. We conducted field surveys throughout the growing season in 2016 and 2017 to monitor changes in community structure, using molecular methods to confirm E. amylovora presence in insect guts. We will focus on pollinators visiting blossoms; hemipterans who provide entry wounds for shoot colonization by E. amylovora; and dipterans visiting oozing cankers on diseased trees. In spring 2018, we will collect insects visiting blossoms, homogenize them, and plate some homogenate on selective media to calculate colony forming units (CFU) per insect. This study will show how much E. amylovora different insects carry, providing deeper insight into the relative importance of different insects interacting with the system.
Objective 2: Investigate acquisition of E. amylovora by Drosophila melanogaster.
Description: Our field survey results indicate that a variety of fly species (diptera) test positive for the presence of E. amylovora. Further, flies were widely observed locating, walking, and feeding on fire blight ooze exuding from infected trees. This information, along with reports from the early 1900s implicating several fly species in fire blight transmission, led us to believe that flies in general can acquire and transmit E. amylovora. Based on this idea, we used Drosophila melanogaster as a model to investigate how flies interact with fire blight ooze to acquire and transmit the bacteria. The goal of this objective is to first establish that flies can acquire the bacteria via ooze, and then to measure key factors promoting acquisition. We will measure fly mating status, hunger state, amount of ooze consumed, exposure time, and fly sex. We will also quantify the number of viable E. amylovora cells in each fly after treatment.
Objective 3: Evaluate E. amylovora persistence in flies using Dipterans captured in the field.
Description: A key factor in E. amylovora epidemiology as it relates to insects is how long the bacteria can persist on/in the insect. The longer the bacteria can persist on/in the insect, the more opportunity it has to colonize healthy plant tissue. We evaluated persistence of E. amylovora in/on flies in an experimentally infected orchard and in laboratory assays using Delia platura, the bean seed fly. This fly was prevalent in the field and tested positive at high rates in our insect survey (objective 1). We measured the amount of time individual flies spend feeding on ooze in the field and the lab, and also measured how much viable E. amylovora these flies leave behind after one acquisition event. We quantified this data daily, thus evaluating how long the bacteria can persist in/on flies.
The purpose of this project is to identify interactions between fire blight (Erwinia amylovora) and potential insect vectors that can be targeted for management. Fire blight is a necrotrophic, bacterial disease of rosaceous plants, causing significant economic losses in apple and pear worldwide. New York is the second largest apple producing state in the country, accounting for over 10% of apple production nationwide with a production value approaching $250 million. To date, growers in the Northeast and elsewhere depend on streptomycin applications to control fire blight, but continued streptomycin use is not sustainable given risks for resistance. Indeed, this risk has recently become a reality, leading to an urgent need for new fire blight control methods.
While it is well known that insects are involved in transmitting fire blight, little in depth data describes how insects acquire and transmit the bacteria or which insects are key players in the interaction. If we had a better understanding of the role of insects in this system, then we could identify interactions to target as new pieces of a more sustainable management regime. Our goal is to better understand the insect-plant-microbe ecology of this system, specifically 1) how insects interact with ooze; 2) whether ooze is attractive to insects; and 3) whether ooze consumption confers benefits on the insect. We believe that fire blight ooze is the first point of contact between many insects and the disease and serves as the inoculum source for most insects, thus representing a quality target for disruption.
This project could broadly impact how we develop new disease management techniques. As concerns for pesticide resistance increase, we will need to turn towards integrated management strategies that take more factors into account. We are grounding our research in an evolutionary approach, acknowledging that fire blight first evolved in a complex environment, where a viable host was not immediately adjacent to an infected host. We believe that insects were the primary mechanism through which E. amylovora moved across complex landscapes, and that fire blight ooze needed to provide enough of a benefit to an insect so it would feed on the ooze and acquire the bacteria. The insect would need to acquire large enough numbers of E. amylovora to give the disease a chance to establish elsewhere, as the insect was likely to encounter several non-host plants before landing on a susceptible one. A single droplet of ooze can contain over a billion cells, which seems excessive when it only takes 20-1000 cells to initiate an infection, but not when grounded in the scenario described above. We believe that this approach will lead us to a better understanding of interactions between fire blight and the insects that transmit it. Further, grounding disease management research in an understanding of the microbe’s original evolutionary environment can be applied to other pathosystems, especially to similar diseases, helping us develop new disruption techniques that strengthen the sustainability of agricultural systems across the Northeast US.
Cooperators
Research
Objective 1: Identify candidate insect vectors of E. amylovora.
Pollinator survey: During bloom in May of 2016 and 2017, observers collected bees and flies visiting open flowers in an experimentally infected orchard on a research farm at the New York State Agricultural Experiment Station in Geneva, NY. The orchard consisted of 4 blocks, 1 of jonagold and 3 of gala. Once an insect landed on a blossom, they were collected in a 15mL conical tube and frozen on dry ice. Insects were identified to genus or morphospecies, catalogued, and stored in 200µl of TE buffer at -20℃ until they were tested for fire blight via PCR (described below). Sampling continued for about 10 days, until most of the petals had fallen from the trees.
Field Survey: starting in late April of 2016 and 2017, yellow sticky cards were deployed in an experimentally infected orchard on a research farm at the New York State Agricultural Experiment Station in Geneva, NY. The orchard consisted of 4 blocks, 1 of jonagold and 3 of gala. Each week, 5 trees were selected at random from each block, and 2 cards were deployed into each tree, 1 at shoulder height in the canopy and 1 at knee height at the trunk. Cards were collected each week, leafhoppers and flies were identified, catalogued, and removed from the cards. To remove an insect from the card, a small droplet of Goo Gone® was placed on the insect for 20 seconds to dissolve the glue, after which the insect could easily be removed from the card. Each insect was stored individually in 200µl of TE buffer and stored at -20℃ until they were tested for fire blight via PCR. The experiment lasted for 20 weeks in 2016 and 18 weeks in 2017.
CFU survey: In 2018, we will sample insects visiting blossoms or oozing tissue, homogenize them, and plate them on Crosse-Goodman media to measure colony forming units (CFU). Crosse-Goodman is a selective growth media, on which E. amylovora colonies develop characteristic craters, making them easily discernable from other bacteria on the plate. Insects will be collected from diseased trees in the experimentally infected orchard described above using 15 or 50mL conical tubes and stored on ice until they are returned to the lab. In lab, insects will be catalogued and hand homogenized with a pestle in 100-500µl of dH2O depending on the size of the insect. 1µl of that homogenate will be plated on CG media, and the plate will be sealed with parafilm and incubated at 28℃ for 36-48 hours. E. amylovora cells will be identified and counted to determine total CFU/insect. Additionally, we will collect blossoms that insects were captured on, homogenize or wash the tissue, and plate 1µl of that sample on CG media. We will sample throughout bloom (about 10 days) and 1 time/week until shoots stop oozing in ~late July.
DNA Extraction: single 7mm BBs were added to each sample, and insects were homogenized in a tissuelyzer machine for 30 seconds at 30 rotations/second. 5µl of homogenate was added to a 0.2mL tube with 5µl of lysis buffer containing proteinase K. Samples were mixed with buffer by drawing liquid slowly through a pipette and then stored at -80℃ for 1 hour. Next, samples were transferred to a thermocycler and incubated for 60 minutes at 60℃ to activate the proteinase K, and then 15 minutes at 95℃ to deactivate the proteinase K. Extracted DNA was stored at -20℃ until PCR reaction.
PCR: 1µl of DNA was added to 11.50µl PCR master mix containing 6.25µl EmeraldAmp® PCR Master Mix, 4.75µl dH2O, and 0.25µl each of forward and reverse primer. Primers AJ75 (AACCGCCAGGATAGTCGCATA) and AJ76 (CGTATTCACGGCTTCGCAGAT) amplified an ~800bp region of the pEA29 plasmid, which is ubiquitous in E. amylovora (McManus and Jones 1995). Samples were run under a standard PCR protocol of denaturation at 95℃ for 5 minutes, 35 cycles of denaturation at 95℃ for 30 seconds, annealing at 52℃ for 30 seconds, and extension at 72℃ for 30 seconds, with a final extension cycle of 72℃ for 7 minutes. PCR products were run on 1% Agarose gels stained with SYBR™ Safe DNA Gel Stain for 30 minutes at 120 volts before being imaged under ultraviolet light to identify positive samples.
Objective 2: Investigate acquisition and transmission of E. amylovora by Drosophila melanogaster.
Preliminary acquisition trial: Four holes were punctured into Red delicious apples (harvested as fruitlets about 1 inch in diameter) using a dental tool. 200µl of E. amylovora suspension (1 E. amylovora colony grown overnight in 50mL of LB broth at 28℃ with 100rpm shake cycle) was injected into each wound, and wounds were sealed by scraping E. amylovora colonies from CG media plates across the injury. Fruitlets were incubated in individual cups with a humidity source at 28℃ for about 7 days until ooze droplets formed across the surface of the fruit. Next, single 3-day old D. melanogaster were added to each fruitlet cup and exposed to the fire blight ooze in this manner for one of 4 exposure times: 3, 6, 24, or 48 hours. Each exposure time had 30 replicates. After the treatment period ended, flies were removed and sexed before DNA extraction, PCR, and gel electrophoresis were done on each replicate as described above. Number of positive samples were tabulated and analyzed using generalized linear models in R.
Acquisition factors trial: This experiment measures various factors that may contribute to fire blight acquisition: sex (male or female); mating status (mated or unmated); hunger state (hungry or satiated); amount consumed (ooze vs sucrose); and exposure time (3, 6, 12, 24, or 48 hours). These experiments were conducted in a CAFE (Capillary Feeding) arena. The arena consists of an inner and outer chamber. The outer chamber, a 50mL conical tube, contained damp cotton at the bottom as a humidity source. The inner chamber secures to the inner rim of the 50mL conical tube cap, and has six holes drilled in the bottom so humidified air can pass through. A hole is drilled through the 50mL conical tube cap, and a truncated pipette tip inserted into it. A 5µl capillary tube containing either treatment or control diet is inserted through the pipette tip. 1 µl of mineral oil is inserted to limit evaporation. The fly is contained in the inner chamber for the duration of the experiment. This set up ensures that the fly only acquires the bacteria via feeding during the experiment rather than acquiring the bacteria on its body.
Fruitlets were infected as described above and incubated for 4-7 days at 28℃. When ooze droplets formed, 3-5 droplets were removed from the fruit with a pipette and homogenized in 200µl dH2O by drawing the droplet up and down with a pipette until the liquid became opaque and no solids were visible. 5µl of this suspension was drawn into a capillary tube as diet for exposure treatments. Ooze was loaded into capillary tube using a pipette to avoid getting bacteria on the external surface of the tube. Control flies were treated with capillary tubes containing 5% sucrose.
Unmated flies: Pupae close to eclosion were removed from the colony and placed into individual vials containing Carolina instant Drosophila diet. Once eclosed, flies were given 24 hours on “normal” diet before being moved into the CAFE arena for a 24-hour habituation period, with a 5% sucrose capillary provided for food. After the habituation period, flies to be starved were provided dH2O for 24 hours, while satiated flies were provided 5% sucrose for another 24 hours. The next day, these 3 day old flies were treated with either 5% sucrose or ooze solution and exposed to the food source for their designated exposure time. After exposure, capillary tubes were removed and amount consumed was measured using a dial caliper (mm). Control vials containing no flies were used to measure evaporation, and average evaporation was subtracted from final amount consumed totals. Flies were transferred to 1.5mL Eppendorf tubes and put on ice for 5 minutes, then sexed and homogenized. 1µl of homogenate was spread on CG media plates and plates were incubated at 28℃ for ~48 hours. Colonies were then counted to determine colony forming units per insect. Data was analyzed using generalized linear models using various distributions in R. Total replicates: 600.
Mated flies: pupae were allowed to emerge in colony vials and given 24 hours in colony to mate. Flies were released into a cage and females were captured and moved to individual CAFE arenas for habituation. Above procedure was followed for all factors described above. Total replicates: 600.
Objective 3: Evaluate E. amylovora persistence in flies using Dipterans captured in the field.
Field persistence assays: In June and July 2018, oozing shoots and branches were observed for visiting flies in an experimentally infected orchard on a research farm at the New York State Agricultural Experiment Station in Geneva, NY. When flies started feeding on ooze, they were timed until feeding ceased, and then captured in a 15mL vial. Flies were returned to the lab, provided a small piece of paper towel soaked in 5% sucrose for sustenance in the 15mL vial, and kept in an environmental chamber at 16/8 D/N and 50% RH. Each day, flies were transferred to a new vial, and the previous days' vial was washed with distilled water to bring E. amylovora left behind by the fly into solution. This solution was serially diluted, and dilutions were plated on Crosse-Goodman (CG) media. After two days of incubation, at 28°C and >90% RH, E. amylovora cells were counted. This process was repeated every day until the fly died or until no E. amylovora was left behind, providing a measure of how long E. amylovora persists in/on the fly and if enough E. amylovora is left behind by the fly over a given time period to create the potential for a new infection.
Lab persistence assay: Apple fruitlets were inoculated with E. amylovora as described above and suspended from the lid of 570mL deli cup with a metal wire. A single Delia platura (a fly species ubiquitous in the experimentally infected orchard that frequently tested positive for E. amylovora) from a lab colony was placed into the container and allowed to locate the oozing fruitlet. When the fly started feeding, it was timed for the duration of the feeding bought, then captured in a 15mL tube and treated as above.
Objective 1: Identify candidate insect vectors of E. amylovora.
- Over 900 pollinators tested across all three seasons with 0% testing positive for fire blight. These data require further analysis, so the conclusions are still preliminary, but it is interesting and unexpected. Most reports indicate that honey bees are the major transmitters of fire blight during bloom, but this data suggests that not only honey bees, but also other wild bees are not necessarily responsible for transmission in spring. Over the course of bloom periods in 2016 and 2017, we observed flies visiting blossoms at high rates. Reports on honey bees indicate that they are not attracted to ooze and flies are. If flies are visiting ooze and blossoms, they could be major disease transmitters rather than honey bees. Our 2018 field survey shows low percentages of positive Dipterans and Hymenopterans collected from blossoms. However, this is likely due to the low percentage of E. amylovora positive blossoms tested in the experimentally infected block. Out of 50 trees sampled, only 4 trees had blossoms positive for E. amylovora. On positive trees, the number of positive blossoms increased rapidly by day, but no insects captured visiting those blossoms tested positive. This data requires deeper analysis, but there are many possible reasons for this outcome. It could be that 2018 was simply a bad year for blossom blight. Bloom was slightly delayed due to weather, and then occurred over a shorter period of time once the weather improved, it is unknown how this type of weather pattern affects blossom blight, but if levels of blight were low in general, that would preclude high levels of infected insects during bloom. Alternatively, insects may simply be unimportant during bloom and more important during the early season when young succulent shoots are growing. Many insects approach blossoms from the side to drink the nectar precluding them from coming in contact with the stigma, which is the main location of E. amylovora on blossoms, so insect behavior may play a role in acquisition. These hypotheses need to be studied further to advance one or the other, this data is too preliminary to make a claim for either.
- About 2,500 potato leafhopper were tested across both field seasons, with over 1% of the total testing positive. In a given week, number of positives ranged from 0%-2%, suggesting a fairly wide range of possibilities. This range is biologically relevant, as leafhopper vectors in other systems carry pathogens within or slightly above this range. This data is encouraging because it supports our hypothesis that a variety of insects can at least acquire amylovora. We are still analyzing this data, so all results are preliminary and require deeper analysis, but the initial outcome appears promising.
- About 2,000 flies of various morphospecies were tested for the 2017 field season with 0%-5% testing positive in a given week. Delia platura and Delia florilega were identified by the Cornell Insect Diagnostic Lab as the predominant species in our field surveys. This data is still being analyzed, so all results are preliminary, but it is nonetheless encouraging. We believe flies are the primary fire blight acquirers and play a major role in the disease’s movement within and within and between trees. This data supports our belief that flies in general play a role in this system rather than just one specific fly, which further supports our use of melanogaster as a fly model in laboratory experiments. Throughout field experiments, we observed all fly morphospecies landing on diseased branches, walking up to fire blight ooze of all colors and probing/feeding on the ooze. While these observations were not scientifically collected, they anecdotally support our running theory described above.
Objective 2: Investigate acquisition of E. amylovora by Drosophila melanogaster.
- Preliminary acquisition trials confirmed that D. melanogaster can acquire E. amylovora at high rates and that there was a significant positive effect of time on acquisition (p<0.001). Biologically, this means that the longer the fly is exposed to a diseased fruitlet, the more likely it is to test positive. Time points were grouped into three categories (0-3 hours, 12 hours, and 48 hours) and analyzed using a generalized linear model with a binomial distribution. While the 0-3 hour and 12-hour exposure periods were not significantly different from each other (3% positive and 17% positive respectively), they both tested positive at significantly lower rates than the 48-hour exposure period (63% positive). This experiment opened a host of questions that we evaluated in another acquisition experiment. We were interested in how biological factors such as nutritional state, mating status, and sex affect
- Acquisition factors: Exposure time had a significant positive effect on acquisition of E. amylovora by D. melanogaster such that increasing exposure time led to an increased percentage of positive individuals (χ2 = 24.08, p < 0.001).
- Exposure time had a significant negative effect on the abundance of E. amylovora in individual D. melanogaster indicating that a longer exposure time led to decreased CFU/insect levels (χ2 = 3.92, p = 0.048). This is likely due a significant drop in CFU at 24hr of exposure. The reason for this drop could be methodological or biological, but we believe the overall negative effect is not biologically relevant in this system.
- There was a significant positive effect of food deprivation on E. amylovora abundance in individual D. melanogaster (χ2 = 5.36, p = 0.02). This suggests that a fly with a lower overall nutritional state is likely to acquire higher levels of E. amylovora, meaning that in the field a fly that is searching for food and discovers ooze may feed longer and therefore acquire more bacteria, though this hypothesis requires further evaluation.
- There was a marginally significant positive effect of mating status on E. amylovora abundance in individual flies such that unmated flies acquired slightly higher titers than mated flies (χ2 = 3.68, p = 0.055). This could be due to differences in behavior based on mating status, where mated females are likely searching for an oviposition site rather than a feeding.
- Sex had no significant effect on acquisition, which was unexpected because sex affects the acquisition of similar bacteria in similar insect vectoring systems. While we cannot definitively state why sex had no effect on acquisition, we hypothesize that the lack of difference is due to insect behavior. Males and female D. melanogaster tend to have both oviposition sites and feeding sites at the same location, meaning their behavior may not be significantly different from each other once a feeding/oviposition site is located. In other systems, the oviposition site is not at the feeding site, and the female fly generally interacts more with different substrates that would lead to higher abundances of bacteria than male flies. Further study is required to advance this hypothesis, so this is currently conjecture.
Objective 3: Evaluate E. amylovora persistence in flies using Dipterans captured in the field.
- E. amylovora persisted on/in the Delia platura for up to seven days. This result was unexpected, as we predicted the bacteria would persist for 2-3 days maximum. While the effect of long term persistence on/in flies on transmission of E. amylovora to new hosts is unknown, we predict that the longer the bacteria can persist on/in the fly, the more likely successful transmission will be. Our next set of experiments will investigate factors affecting the transmission of E. amylovora by flies. We also do not know why the bacteria can persist for so long in the fly. There may be genetic or behavioral factors that affect persistence, though those experiments were outside the scope of this grant. The location of the bacteria on or in the fly is also unknown, though previous studies showed that E. amylovora could adhere to the legs and mouth parts of other insects and in the gut of other species of flies.
- CFU across time in days staid relatively stable over time, suggesting that D. platura can maintain a relatively constant amount of bacteria on/in them for an extended period of time. The mechanism governing this phenomenon is unknown and requires further study to understand.
- The average retention of E. amylovora in Delia platura was about 1.86 days.
- The average feeding time on ooze droplets was roughly 4.67 minutes.
- Initial E. amylovora titer was a strong predictor of retention (in days), meaning that the higher the initial titer, the more days E. amylovora persists in/on the fly (p = 0.003).
- Nutritional state was a strong predictor of retention (p = 0.02) such that a food deprived fly was likely to retain E. amylovora longer than a satiated fly.
- Nutritional state was a strong predictor of feeding time (p < 0.001) such that a food deprived fly fed on ooze longer than a satiated fly.
- These conclusions are still preliminary, as further data analysis is required. Overall, the data from this study shows that Dipterans are capable of retaining E. amylovora for extended periods of time following acquisition, which is a key component in the epidemiology of this disease.
Collectively, this research project underscores and elucidates the role of Dipterans in Erwinia amylovora epidemiology. We have established that flies are capable of acquiring the bacteria from ooze, that flies feed on ooze, and that the bacteria can persist long term on/in the body of the insect. There is still significant progress required before we can make recommendations to farmers on how to manage insects that may transmit the disease. Primarily, we still need to understand how efficient flies are at transmitting the bacteria to healthy hosts and what biotic and abiotic factors contribute to transmission of E. amylovora by flies. We have shown that the acquisition phase is ecologically dynamic and that an insect's behavior and nutritional state factor in to the abundance of bacteria and individual acquires. It is likely that the transmission phase is also ecologically dynamic, and it will be important to understand those dynamics before pursuing management avenues.
Education & Outreach Activities and Participation Summary
Participation Summary:
In July 2016, I gave a presentation about our work and our goals to over 300 apple growers from around the world at the Cornell Fruit Field Day. In November 2016, I presented preliminary data on this project to a panel of apple growers from across New York State as part of an Apple Research and Development Program review. I've given academic talks at the Cornell Entomology Symposium in January 2016 and 2017, a poster and a talk at the New York State Agricultural Experiment Station Symposium in June 2016 and 2017 respectively, and another talk to agricultural researchers from across the country at the Entomological Society of America's annual meeting in November 2017. An article on this research was also published in Good Fruit Grower in September 2016. In 2018, I have presented research at the International Congress of Plant Pathology and will present more data at the Entomological Society of America meeting in November. We submitted a research article on factors affecting acquisition of E. amylovora by D. melanogaster to Applied and Environmental Microbiology, which is currently in review. We plant to publish another article on the field surveys/persistence data collected in this project in early 2019. We are also writing an article on our findings for New York Fruit Quarterly, which will help update farmers on our most recent findings. This article will be published in late 2018 or early 2019.
Project Outcomes
While this project has no immediate affect on agricultural sustainability, we have laid the foundation to get their in the future. Once we understand the final phases of insect facilitated transmission of fire blight, we can then imagine management strategies with that information in hand. Future management strategies could help reduce losses due to fire blight, saving growers financially, and/or mitigate the risk of E. amylovora resistance to antibiotics. For now, we will educate growers and other stakeholders on our new understanding of the role of insects in the disease cycle and continue trying to understand the final stages of this interaction.
Over the course of this grant, I have learned how to approach problem based research questions in both the field and the lab, and how to develop research projects geared towards applied outcomes. The process of producing research that has significant, effective applied outcomes involves understanding the basic ecological questions governing the system, followed by expanding that understanding to a management approach. While we did not get to evaluate management outcomes during this time frame, this project provides a basic blueprint showing how to get to that point. Careerwise, I hope to pursue a faculty position in agricultural entomology/plant pathology and continue working on sustainable solutions to agricultural problems. I am especially interested in the intersection between insects and plant diseases in vegetable crops and tree fruit. For the remainder of my PhD, I will study how fire blight ooze affects the fitness of insects that vector it as well as the factors affecting transmission of the disease via insects.
Moving forward, we will study how insect behavior changes in response to infected plant tissue. In the spring/summer of 2019, we will run a large transmission trial in the greenhouse to understand what biotic/abiotic factors contribute to effective transmission by insects.