Final report for GS19-199
Project Information
Viral diseases impose severe limitations on papaya production worldwide, including growing regions of southern Florida, Puerto Rico, and Hawai'i. The most significant of these is papaya ringspot virus (PRSV), which dramatically reduces marketable yield and can lead to plant stunting or death. All types of papaya are susceptible to PRSV, except where resistance has been genetically engineered. The virus cannot be directly controlled, so disease management often includes regular chemical sprays to reduce abundance of the aphid vector. The challenges of controlling pathogenic plant viruses with the associated risks to pesticide applicator, the environment, and consumers are common across most food crops. Innate genetic resistance is therefore the best defense against viral pathogens.
In the case of transgenic papaya, such resistance has been achieved through expression of the viral coat protein gene. Unfortunately, the utility of resistant varieties has been attenuated by negative public perception of “GMOs”, limited availability and diversity of resistant germplasm, and the emergence of viral strains impervious to coat protein-mediated resistance. As a result, new solutions are urgently required.
Towards this end, we have explored two potential strategies to enable papaya production that is both profitable and sustainable. First, we evaluated the use of transgenic, PRSV-resistant papaya border rows to shelter high-value plantings of susceptible varieties. Unfortunately, this technique did not effectively slow the spread of PRSV in our southern Florida field trial. Our other objective was to impart broad-spectrum virus resistance via genome editing. In the process, we developed the first CRISPR/Cas9 mediated genome editing protocol for Carica papaya, with an estimated efficiency > 80%. Papaya plants have now been successfully transformed with CRISPR/Cas9 constructs targeting eIF4E and eIF(iso)4E, genes associated with potyvirus resistance in many other plant species. Regeneration of genome-edited papaya lines is currently ongoing. After genotyping, rooting, and acclimation to the greenhouse, papaya plants will be inoculated with PRSV to assess resistance.
- Evaluate the use of PRSV-resistant border plantings to protect susceptible papaya varieties.
- Develop an efficient genome editing protocol for papaya.
- Generate virus resistant papaya accessions through consumer-friendly biotechnology.
Cooperators
- (Educator and Researcher)
Research
Objective: Evaluate the use of PRSV-resistant border plantings to protect susceptible papaya varieties.
The use of PRSV-resistant border rows to protect susceptible varieties was pioneered by researchers at the USDA-ARS in Hawai'i with promising preliminary results (Matsumoto et al., 2014). The strategy relies on the non-persistent manner in which aphids transmit PRSV. The rationale is that infectious vectors are likely to feed first on resistant plants at the perimeter of the field. In the process, the proboscis and stylus are cleansed of the virus, preventing subsequent transmission. We evaluated the efficacy of this PRSV-management technique under southern Florida’s distinct growing conditions using regionally relevant papaya accessions.
The field trial was established at University of Florida’s Tropical Research and Education Center (TREC) in Homestead, Florida in spring 2020. PRSV resistant border plants were derived from open-pollinated seeds of the University of Florida breeding line S40-2228 (Davis and Ying, 2004). ‘Red Lady 786 F1 Hybrid’ from Known-You Seeds was used as the susceptible cultivar. This pair of accessions was selected due to their comparable stature and the popularity of ‘Red Lady’, a PRSV-tolerant, large-fruited accession, with south Florida growers. Seeds were sown in the greenhouse on January 21, 2020 and transplanted March 30, 2020. The field plot consisted of 21 rows with 37 plants in each row. Spacing was 5 ft within-row and 12 ft between rows.
The experiment included two treatments with four replicates each in a randomized row-column design. Treatment A consisted of 6 susceptible ‘Red Lady’ plants surrounded by 3 additional rows of ‘Red Lady’ seedlings on all sides. Treatment B consisted of 6 susceptible ‘Red Lady’ plants surrounded by 3 rows of PRSV resistant OP S40-2228 seedlings. Each replicate plot was surrounded by one additional row of ‘Red Lady’ plants on all sides. These plants were artificially inoculated with PRSV on July 20 and again on August 3, 2020, to ensure disease pressure throughout the field. Leaf samples were collected monthly and on September 27, 2020, the 6 interior plants within each replicate plot were visibly scored for presence or absence of PRSV symptoms.
Objective: Develop an efficient genome editing protocol for papaya.
An early step towards using CRISPR/Cas9 for crop improvement is protocol development in the species of interest. In plants, the phytoene desaturase (PDS) gene is a common preliminary target. PDS is an attractive candidate for CRISPR/Cas9 mediated knockout, as the resulting mutants should have an albino phenotype. This enables rapid visual assessment of genome editing efficiency.
The papaya CpPDS CDS sequence were retrieved from Phytozome v13 Carica papaya genome ASGPBv0.4. Guide RNAs within the first two exons were chosen using CRISPOR (Concordet and Haeussler, 2018). The following candidate gRNA targets on either strand with an NGG PAM sequence and high predicted specificity (MIT score ≥97) were selected: gRNA1: TCGATAACCACATTTCGAGG, gRNA2: GAGCTGTTAAGATTAGGTCC, gRNA3: TGGACGGGGAGAAGTCCGAA.
Binary vectors pAC0025 and pAC0026 were constructed using golden gate modular cloning (MoClo) (Weber et al., 2011). pAC0026 was used as a negative control for genome editing and contained cassettes for GFP (green fluorescent protein, visual marker), hptII (hygromycin resistance), and zCas9i (Zea maize codon-optimized, intronized Cas9) expression in the level M acceptor pAGM8031. In addition to these three cassettes, pAC0025 also contained gRNA transcriptional units targeting the PDS gene. These were prepared as described in figures S15 and S16 in (Grützner et al., 2020). Finally, GFP, hptII, zCas9i, and gRNA transcriptional units were assembled in the acceptor plasmid pAGM8031 yielding pAC0025. Completed CRISPR constructs were transformed into Agrobacterium tumefaciens strain GV3101 by electroporation.
Embryogenic callus tissue was obtained from immature papaya seeds as described in Cai et al., 1999. Tissue was subsequently transferred to liquid multiplication media (0.5X MS Salts, 1X MS Vitamins, 60 g/L sucrose, 2 mg/L 2,4-D) and maintained in liquid culture for at least 7 weeks and up to 6 months prior to transformation.
Papaya transformation was carried out using the method described in (Zhu et al., 2006). Four weeks after transformation, filter paper and papaya tissue were moved to fresh multiplication media with 50 mg/L hygromycin for selection. Tissue was incubated on selective multiplication media and subcultured monthly for a total of 3 to 4 months before transfer to MBN shoot regeneration media (1X MS Salts, 1X MS Vitamins, 30 g/L sucrose, 200 µg/L BA, and 200 µg/L NAA), 0.8% agar with 50 mg/L hygromycin and placed under lights with 16 hours light / 8 hours dark per day.
After 3 to 4 months on MBN shoot regeneration media, all regenerating plants were visually scored as either dark green (wild-type), pale green, or albino. Genomic DNA was extracted from 10 putative PDS mutants (pAC0025-transformed lines) as well as 1 untransformed plantlet and 1 plant line transformed with the negative control construct pAC0026. PCR was carried out to amplify the CpPDS region targeted by gRNAs. PCR product was ligated into a pJET1.2 blunt-end cloning vector (ThermoFisher, Waltham, MA), and transformed into Top10 E. coli. Purified plasmids were sent for Sanger sequencing with primer AC0419 (TGTGTCAAAAACAGGGCAACC) for characterization of CRISPR/Cas9 mediated mutations.
Objective: Generate virus resistant papaya accessions through consumer-friendly biotechnology.
While there is no known potyvirus resistant Carica papaya germplasm, natural resistance in other species can frequently be attributed to eIF4E alleles (Bruun-Rasmussen et al., 2007; Charron et al., 2008; Hwang et al., 2009; Nicaise et al., 2003; Nieto et al., 2006; Ruffel et al., 2005; Ruffel et al., 2006). eIF4E is an mRNA cap-binding protein involved in the initiation of translation in eukaryotes. Plants typically have at least one copy of eIF4E and its isoform eIF(iso)4E, and in some species they are part of small gene families (Mazier et al., 2011). Many single-stranded, positive sense RNA viruses require interaction with these host proteins in order to successfully infect and replicate within the plant (Eskelin et al., 2011; Miras et al., 2017). Naturally occurring immunity to these viruses is often due to a mutation in either gene that prevents this interaction. There have now been numerous instances where genetic engineering has been used to create potyvirus resistance via manipulation of eIF4E or eIF(iso)4E, including overexpression of alleles that the virus is unable to interact with effectively (Cavatorta et al., 2011; Kang et al., 2007), RNAi-mediated knockdown of native eIF4E or eIF(iso)4E (Mazier et al., 2011; Miroshnichenko et al., 2020), and knockouts developed using CRISPR (Chandrasekaran et al., 2016; Gomez et al., 2017; Mazier et al., 2011; Pyott et al., 2016; Rodríguez-Hernández et al., 2012; Wang et al., 2013).
Carica papaya appears to have a single copy each of eIF4E and eIF(iso)4E. As it is currently unclear whether PRSV preferentially utilizes eIF4E or eIF(iso)4E for replication in this host, we have targeted both independently with a CRISPR/Cas9 system.
Carica papaya eIF4E and eIF(iso)4E gene candidate sequences (CpeIF4E and CpeIF(iso)4E) were retrieved from NCBI; Gene ID 110819822 and 110815929, respectively. Guide RNA design was carried out using CRISPOR (Concordet and Haeussler, 2018). Three targets were selected for each gene (Table 1) within the first two exons and with low predicted off-target activity (MIT specificity score ≥97).
Table 1. List of guide RNA (gRNA) sequences deployed to target the Carica papaya eIF(iso)4E and eIF4E genes (CpeIF(iso)E4 and CpeIF4E).
|
Gene Target |
gRNA # |
gRNA Target Sequence |
|
CpeIF(iso)4E |
1 |
GGAGGGGAGCACCGTAGCGG |
|
CpeIF(iso)4E |
2 |
ACGGAGAGAGGAGCCCCAAG |
|
CpeIF(iso)4E |
3 |
TTCCCCCCATTAGCGCACTC |
|
CpeIF4E |
1 |
GGATGTGGATGATAGTTTGG |
|
CpeIF4E |
2 |
GTATACGTTCCGAACTGTTG |
|
CpeIF4E |
3 |
GCTCCAACAGCCAACTTGCT |
Binary vectors pAC0024, pAC0026, and pAC0027 were constructed using golden gate modular cloning (MoClo) (Weber et al., 2011). Cloning was carried out as described under the previous objective (genome editing protocol development), except with gRNAs designed to target CpeIF4E (construct pAC0027) and CpeIF(iso)4E (construct pAC0024) rather than CpPDS. Agrobacterium-mediated transformation was again carried out using the method described by Zhu et al., 2006.
Objective: Evaluate the use of PRSV-resistant border plantings to protect susceptible papaya varieties.
Six months after trial establishment, plants were 5 to 6 ft tall and bore mature green fruits, but none had yet begun to ripen. Classic PRSV symptoms were evident throughout the field including mosaic, chlorosis, and distorted leaves, as well as ring spots on the surface of green fruits. The 6 interior plants within each replicate plot were visibly scored for presence or absence of PRSV symptoms on September 27, 2020 (Table 2). PRSV symptoms were apparent on at least 1 of the 6 plants in every replicate, regardless of border row treatment. Overall, more than 40% of monitored plants were visibly infected across both treatments.
The use of PRSV resistant papaya in border rows did not prevent transmission of the virus to the susceptible cultivar ‘Red Lady’. There are numerous reasons why a border row management strategy may have been successful in Hawai'i but not in our experience. These include the presence of an old PRSV-infected papaya field within 50 ft of our trial, frequent high wind conditions in Homestead (which may disperse the aphid vector widely), and the early stage at which we transplanted seedlings to the field.
Table 2. Number of plants with PRSV symptoms after 6 months. The 6 ‘Red Lady’ plants in the center of each plot were visually scored (presence / absence) for PRSV symptoms six months after transplanting. The number of symptomatic plants as of September 27, 2020, in the table. Treatment A consisted of three rows of PRSV-susceptible ‘Red Lady’ papaya plants surrounding each replicate plot. Treatment B consisted of three rows of PRSV-resistant OP S40-2228 papaya plants surrounding each replicate plot.
|
Border row type |
Number of symptomatic plants per replicate plot |
Total symptomatic plants |
Overall % symptomatic plants |
|||
|
1 |
2 |
3 |
4 |
|||
|
Treatment A: Susceptible borders |
4 |
1 |
3 |
3 |
11 of 24 |
46% |
|
Treatment B: Resistant borders |
5 |
3 |
1 |
1 |
10 of 24 |
42% |
Objective: Develop an efficient genome editing protocol for papaya.
A total of 73 plant lines stably transformed with pAC0025 (CRISPR construct targeting CpPDS) were obtained. Of these, 59 (81%) were fully albino. Of the remaining 14 lines, 7 were pale green and 7 were dark green (wild-type) in appearance. Additionally, 78 papaya lines transformed with the negative control construct pAC0026 were recovered. None of these were albino and only 3 had a pale green phenotype. The remaining 75 plant lines (96%) were dark green. Similarly, all 31 untransformed control lines were dark green.
Genotyping of the targeted region within CpPDS was carried out for a subset of the transformed papaya lines. This included one untransformed control, one line transformed with pAC0026 (no gRNA construct), and ten pAC0025 (CpPDS construct) lines. Alignment of Sanger sequencing results revealed diverse edits in pAC0025-transformed plants, including insertions of up to 415 bp, inversions and large deletions between gRNA target sites, and many smaller deletions (Table 3). Mutations were typically observed at all three gRNA target sites. However, in one of the lines (pAC0025 #78), no edits were found. This plant also has a dark green / wild-type phenotype, indicating that while it is transformed it has not been successfully edited.
Overall, the high percentage of albino plants recovered in combination with the abundance of mutations observed at all three CpPDS gRNA target sites suggests that we have developed an efficient genome editing protocol.
Figure 1. Examples of the range of phenotypes observed in plants transformed with pAC0025, the construct targeting CpPDS. A) Wild-type phenotype (dark green), B) Pale green phenotype, and C) Albino phenotype.
Table 3. CpPDS genotypes of plant lines transformed with pAC0025. “-“ indicates a deletion, “+” an insertion, and “inversion” denotes that the sequence between cut sites has been excised, reversed, and re-ligated. “WT” indicates wild-type sequence, or the absence of mutations.
|
Line # |
Phenotype |
Allele |
gRNA1 |
gRNA2 |
gRNA3 |
|
1 |
Albino |
A/B (homozygous) |
-112 bp |
-7 bp |
|
|
15 |
Albino |
A/B (homozygous) |
-112 bp |
-53 bp +8 bp |
|
|
31 |
Albino |
A |
-112 bp |
-5 bp +415 bp |
|
|
B |
300 bp inversion, -1 bp at gRNA2, -3 bp at gRNA3 |
||||
|
36 |
Albino |
A |
300 bp inversion, -2 bp at gRNA2, -1 bp at gRNA3 |
||
|
B |
300 bp inversion, -1 bp at gRNA2, +1 bp at gRNA3 |
||||
|
47 |
Pale Green |
A |
-309 bp |
||
|
B |
300 bp inversion, -1 bp at gRNA2, +2 bp at gRNA3 |
||||
|
62 |
Albino |
A |
-12 bp |
-4 bp |
-4 bp |
|
B |
-113 bp |
+360 bp -9 bp |
|||
|
63 |
Albino |
A |
-5 bp |
-196 bp |
|
|
B |
-113 bp |
-2 bp |
|||
|
64 |
Albino |
A |
-112 bp |
-1 bp |
|
|
B |
-113 bp |
-5 bp |
|||
|
78 |
Dark Green (WT) |
A/B (homozygous) |
WT |
WT |
WT |
|
110 |
Pale Green |
A |
-309 bp |
||
|
B |
-113 bp |
-1 bp |
|||
Objective: Generate virus resistant papaya accessions through consumer-friendly biotechnology.
We have obtained 13 papaya lines transformed with the construct pAC0024, which targets CpeIF(iso)4E as well as 4 papaya lines transformed with the construct pAC0027, targeting CpIF4E. Currently, these are immature somatic embryos being maintained via tissue culture. CRISPR/Cas9-mediated edits have not yet been characterized, but GFP expression is evident and tissue appears to be hygromycin-resistant, indicating that transformation was successful.
References
Bruun-Rasmussen, M., Møller, I., Tulinius, G., Hansen, J., Lund, O., Johansen, I., 2007. The same allele of translation initiation factor 4E mediates resistance against two Potyvirus spp. in Pisum sativum. Molecular plant-microbe interactions 20, 1075-1082.
Cavatorta, J., Perez, K.W., Gray, S.M., Van Eck, J., Yeam, I., Jahn, M., 2011. Engineering virus resistance using a modified potato gene. Plant biotechnology journal 9, 1014-1021.
Chandrasekaran, J., Brumin, M., Wolf, D., Leibman, D., Klap, C., Pearlsman, M., Sherman, A., Arazi, T., Gal‐On, A., 2016. Development of broad virus resistance in non‐transgenic cucumber using CRISPR/Cas9 technology. Molecular plant pathology 17, 1140-1153.
Charron, C., Nicolaï, M., Gallois, J.L., Robaglia, C., Moury, B., Palloix, A., Caranta, C., 2008. Natural variation and functional analyses provide evidence for co‐evolution between plant eIF4E and potyviral VPg. The Plant Journal 54, 56-68.
Concordet, J.-P., Haeussler, M., 2018. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic acids research 46, W242-W245.
Davis, M.J., Ying, Z., 2004. Development of papaya breeding lines with transgenic resistance to Papaya ringspot virus. Plant Disease 88, 352-358.
Eskelin, K., Hafrén, A., Rantalainen, K.I., Mäkinen, K., 2011. Potyviral VPg enhances viral RNA translation and inhibits reporter mRNA translation in planta. Journal of virology 85, 9210-9221.
Gomez, M.A., Lin, Z.D., Moll, T., Luebbert, C., Chauhan, R.D., Vijayaraghavan, A., Kelley, R., Beyene, G., Taylor, N.J., Carrington, J., 2017. Simultaneous CRISPR/Cas9-mediated editing of cassava eIF4E isoforms nCBP-1 and nCBP-2 confers elevated resistance to cassava brown streak disease. bioRxiv, 209874.
Grützner, R., Martin, P., Horn, C., Mortensen, S., Cram, E.J., Lee-Parsons, C.W., Stuttmann, J., Marillonnet, S., 2020. High-efficiency genome editing in plants mediated by a Cas9 gene containing multiple introns. Plant Communications, 100135.
Hwang, J., Li, J., Liu, W.-Y., An, S.-J., Cho, H., Her, N.H., Yeam, I., Kim, D., Kang, B.-C., 2009. Double mutations in eIF4E and eIFiso4E confer recessive resistance to Chilli veinal mottle virus in pepper. Molecules and cells 27, 329-336.
Kang, B.C., Yeam, I., Li, H., Perez, K.W., Jahn, M.M., 2007. Ectopic expression of a recessive resistance gene generates dominant potyvirus resistance in plants. Plant biotechnology journal 5, 526-536.
Matsumoto, T., Hollingsworth, R., Suzuki, J., Keith, L., Tripathi, S., 2014. Protection and coexistence of conventional papaya productions with PRSV resistant transgenic papaya. Acta Horticulturae 1111, 49-54.
Mazier, M., Flamain, F., Nicolaï, M., Sarnette, V., Caranta, C., 2011. Knock-down of both eIF4E1 and eIF4E2 genes confers broad-spectrum resistance against potyviruses in tomato. PLoS ONE 6, e29595.
Miras, M., Truniger, V., Querol‐Audi, J., Aranda, M.A., 2017. Analysis of the interacting partners eIF4F and 3′‐CITE required for Melon necrotic spot virus cap‐independent translation. Molecular plant pathology 18, 635-648.
Miroshnichenko, D., Timerbaev, V., Okuneva, A., Klementyeva, A., Sidorova, T., Pushin, A., Dolgov, S., 2020. Enhancement of resistance to PVY in intragenic marker-free potato plants by RNAi-mediated silencing of eIF4E translation initiation factors. Plant Cell, Tissue and Organ Culture (PCTOC) 140, 691-705.
Nicaise, V., Retana, S.G., Sanjuán, R., Dubrana, M.-P., Mazier, M., Maisonneuve, B., Candresse, T., Caranta, C., Le Gall, O., 2003. Eukaryotic translation initiation factor 4E (eIF4E) controls lettuce susceptibility to Lettuce mosaic virus, International Congress of Plant Pathology.
Nieto, C., Morales, M., Orjeda, G., Clepet, C., Monfort, A., Sturbois, B., Puigdomenech, P., Pitrat, M., Caboche, M., Dogimont, C., 2006. An eIF4E allele confers resistance to an uncapped and non‐polyadenylated RNA virus in melon. The Plant Journal 48, 452-462.
Pyott, D.E., Sheehan, E., Molnar, A., 2016. Engineering of CRISPR/Cas9‐mediated potyvirus resistance in transgene‐free Arabidopsis plants. Molecular plant pathology 17, 1276-1288.
Rodríguez-Hernández, A.M., Gosalvez, B., Sempere, R.N., Burgos, L., Aranda, M.A., Truniger, V., 2012. Melon RNA interference (RNAi) lines silenced for Cm‐eIF4E show broad virus resistance. Molecular plant pathology 13, 755-763.
Ruffel, S., Gallois, J.-L., Lesage, M., Caranta, C., 2005. The recessive potyvirus resistance gene pot-1 is the tomato orthologue of the pepper pvr2-eIF4E gene. Molecular Genetics and Genomics 274, 346-353.
Ruffel, S., Gallois, J.-L., Moury, B., Robaglia, C., Palloix, A., Caranta, C., 2006. Simultaneous mutations in translation initiation factors eIF4E and eIF(iso)4E are required to prevent pepper veinal mottle virus infection of pepper. Journal of General Virology 87, 2089-2098.
Wang, X., Kohalmi, S.E., Svircev, A., Wang, A., Sanfaçon, H., Tian, L., 2013. Silencing of the host factor eIF(iso)4E gene confers plum pox virus resistance in plum. PLoS ONE 8, e50627.
Weber, E., Engler, C., Gruetzner, R., Werner, S., Marillonnet, S., 2011. A modular cloning system for standardized assembly of multigene constructs. PLoS ONE 6, e16765.
Zhu, Y.J., Fitch, M.M., Moore, P.H., 2006. Papaya (Carica papaya L.), Agrobacterium Protocols Volume 2. Springer, pp. 209-217.
Educational & Outreach Activities
Participation Summary:
Two presentations were made to papaya farmers as well as agricultural professionals and researchers. The first was an oral presentation on the use of virus resistant border rows to protect susceptible papaya varieties, delivered at the 2020 annual meeting of the Florida State Horticultural Society (FSHS). Field study findings were also published in the FSHS 2020 proceedings. The second presentation was an update on the development of virus-resistant papaya using CRISPR/Cas9 technology, delivered at a “GM Papaya Grower Meeting” on October 22, 2020. A manuscript describing an efficient genome editing protocol for papaya was submitted November 2021 and is currently under review.
Project Outcomes
The validation of an efficient CRISPR/Cas9 genome editing system in Carica papaya provides a valuable tool for plant breeders seeking to improve disease resistance, abiotic stress tolerance, postharvest longevity, and other traits that could improve the sustainability of commercial papaya production. We have applied this technique to target the papaya eIF4E and eIF(iso)4E genes with the intention of generating new varieties with a novel mechanism of PRSV-resistance that may be characterized as “non-GMO”.
One objective of this project was to evaluate the use of PRSV-resistant border plantings to protect virus susceptible papaya varieties. Preliminary results from a USDA-ARS study indicate that this management strategy was effective in Hilo, Hawai’i, but we did not achieve reduced or delayed PRSV transmission in Homestead, Florida. This finding has reinforced my awareness that sustainable solutions to agricultural problems should be trialed and validated regionally.
We have obtained papaya plant lines transformed with CRISPR/Cas9 constructs targeting eIF4E and eIF(iso)4E, however we do not yet know what edits have been made in these lines and whether they confer resistance to PRSV. Regeneration of plantlets from undifferentiated tissue is currently underway. After induction of roots and shoots, transformed lines will be genotyped to characterize mutations, acclimated to the greenhouse, and inoculated with PRSV. Plants will be monitored visually for symptoms and viral replication will be assessed via qPCR in order to evaluate resistance versus susceptibility.