Determining the Host-range and Developing Seed-treatment for Managing Bacterial Spot on Pumpkin

Determining Host-Range Plant species tested Fifty plant species (crops and weeds) in 11 plant families, including Amaranthaceae, Brassicaceae, Chenopodiaceae, Cucurbitaceae, Gramineae, Leguminosae, Liliaceae, Malvaceae, Purtulaceae, Solanaceae, and Umbelliferae were tested to determine their susceptibility to X. cucurbitae. Plant inoculation Plants with cylindrical and pinnate leaves were inoculated by spraying the inoculum onto the leaves. Ten milliliters of inoculum were sprayed onto each plant. Plants with broad leaves were inoculated by infiltration of bacterial suspension into the leaf. For each plant species, three plants and two leaves on each plant were inoculated. Development of symptoms (water-soaked and necrotic lesions) was recorded daily. Reisolation of X. cucurbitae from inoculated plants Symptomatic leaves were collected from inoculated plants. Infected tissues were cultured on the KC-agar medium. After 3 days, Xanthomonad-like yellow colonies were subcultured by streaking onto the LB agar medium. Identification of the isolates was accomplished by culturing on yeast dextrose calcium carbonate (YDC) agar medium and a PCR test using primers RST2/3 (5'AGGCCCTGGAAGGTGCCCTGGA3' and 5'ATCGCACTGCGTACCGCGCGCGA3'). Determining Seed-Borne Aspect of Xanthomonas cucurbitae Seed sources Pumpkin seeds were collected from three different sources: (i) 17 commercial pumpkin fields in Illinois; (ii) plots of three pumpkin research trials at the University of Illinois Vegetable Research Farm (Veg Farm) in Champaign, IL; and (iii) three commercial seed companies. During 2010, 17 commercial pumpkin fields were surveyed in Illinois. Ten fruit with bacterial spot were collected from each field. In 2012, pumpkin fruit with bacterial spot were collected from non-chemical treated plots of three research trials. In 2013, nine pumpkin seed lots were obtained from three seed companies. Isolation of X. cucurbitae from whole seed A washing saline solution (WSS) was prepared by adding 7.5 g of NaCl and 200 µl of Tween 20 to 1000 ml distilled water and then sterilized by autoclaving. Three thousand seeds from each lot were tested for presence of X. cucurbitae. Wash suspension of seeds was filtered through sterile cheesecloth and rinsed with 50 ml of sterilized distilled water (SDW). One hundred ml of collected suspension was centrifuged. The pellet was dissolved in buffer. Serial dilutions were prepared from the suspension and 100 µl of the solution was spread on semi-selective kasugamycin-cephalexin (KC)-agar medium in Petri plates. Xanthomonad-like yellow colonies were subcultured on Luria Bertani (LB) agar medium for the identification process of X. cucurbitae. Seedling infection by seedborne inoculum Three seed lots that had been collected from severely infected fruits of pumpkin cultivar Howden, and proven to have infected seed with X. cucurbitae, were tested to determine seedling infection by seedborne inoculum. Six hundred forty seeds from each seed lot were sown in plastic trays (40 seeds per tray of 12x40x60cm) containing a mixture of soil:peat:perlite (1:2:1). The trays were placed in a greenhouse at 24-28°C and watered three times a day. Development of the bacterial lesions was recorded daily until 21 days after seedling emergence. Isolation of bacteria from developed lesions was carried out on KC agar medium in Petri plates. Identification of collected bacterial isolates Bacterial culture. Bacterial isolates were tested first for Gram reaction using 3% KOH. Isolates with Gram-negative reaction were streaked onto yeast-extract-dextrose-calcium-carbonate agar (YDC) medium. PCR test. Isolates with Xanthomonad-like yellow colonies, mucoid and dumbed morphology on YDC medium were selected for PCR test. Primers RST2 (5'AGGCCCTGGAAGGTGCCCTGG A3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3') were used for amplification. Pathogenicity test. X. cucurbitae isolates that were positively identified by culturing and PCR tests were selected to determine their pathogenicity on pumpkin cultivar Howden in a greenhouse. Selected isolates were cultured on LB agar medium. Bacterial inoculum was prepared and inoculated into leaves. ATCC strain 23378 of X. cucurbitae was inoculated as a positive control. For each isolate, three plants were treated, and on each plant three leaves were inoculated. Inoculated plants were maintained in a greenhouse at 24-28°C. During 3 weeks of inoculation, development of water soaked and necrotic lesions were recorded. Symptomatic tissues were processed for isolation of X. cucurbitae, and the recovered isolates were identified as previously described.