Determining the Host-range and Developing Seed-treatment for Managing Bacterial Spot on Pumpkin

Final Report for GNC10-144

Project Type: Graduate Student
Funds awarded in 2010: $10,000.00
Projected End Date: 12/31/2012
Grant Recipient: University of Illinois
Region: North Central
State: Illinois
Graduate Student:
Faculty Advisor:
Mohammad Babadoost
University of Illinois
Expand All

Project Information

Summary:

Pumpkins (Cucurbitae spp.) are grown throughout the world for agricultural purposes (e.g., food and feed) and decoration. Illinois is the leading state in pumpkin production. Bacterial spot, caused by Xanthomonas cucurbitae, has become an important threat to pumpkin production in Illinois. Leaf spots and fruit lesions and rot are major symptoms of this disease, causing up to more than 75% yield losses. This study was conducted to assess host range and seed transmission of X. cucurbitae. To determine incidence of bacterial spot of fruit, 17, 50, and 65 commercial fields were surveyed in 2009, 2010, and 2011, respectively. The symptomatic pumpkins were observed in 100, 80, and 88% of the fields in 2009, 2010, and 2011, respectively. Fifty plants in the family of Amaranthaceae, Brassicaceae, Chenopodiaceae, Cucurbitaceae, Gramineae, Leguminosae, Liliaceae, Malvaceae, Purtulaceae, Solanaceae, and Umbelliferae were tested in a greenhouse for infection by X. cucurbitae. All of the plant species in Cucurbitaceae family developed symptoms and X. cucurbitae was isolated from the lesions. None of the species from other plant families developed symptoms. Seed transmission of X. cucurbitae in pumpkin seeds was tested in the lab and greenhouse. X. cucurbitae was isolated from 12 of 20 seed samples collected from pumpkin fields. Also, X. cucurbitae was detected in kernels of NaClO-surface disinfested seeds. In a greenhouse study, lesions developed on cotyledons of the seedlings grown from naturally-infected pumpkin seeds and X. cucurbitae was isolated from symptomatic leaves.

Introduction:

Pumpkin is a high-value crop grown throughout the United States (US). Approximately 1.5 billion pounds of pumpkins are produced in the US every year. Illinois with about 25,000 acres ranks first in pumpkin production in the US. More than 90% of processing pumpkin are grown and processed in Illinois. Bacterial spot, caused by Xanthomonas cucurbitae has become one of the most economically important diseases on pumpkins and a serious threat to the industry. Leaf spots and fruit lesions and rot are major symptoms of this disease, causing up to more than 75% yield losses. In the past five years, the disease has become more prevalent in Illinois and other Midwestern states and many growers complain about the yield losses and of lack of effective disease management measures. Developing effective management of bacterial spot of pumpkin has not been feasible because of lack of sufficient information on the etiology of the disease. This is proposal for a two-year project to generate necessary information on the etiology of bacterial spot of pumpkin and develop effective methods for management of the disease.

Project Objectives:

This is proposal for a two-year project to generate necessary information on the etiology of bacterial spot of pumpkin and develop effective methods for management of the disease. The specific objectives of this research are to: (1) identify the host-range of X. cucurbitae; (2) determine the importance of seed-borne aspect of the pathogen; and (3) develop management of the disease, emphasizing effective seed-treatments and cropping rotations.

Research

Materials and methods:

Determining Host-Range

Plant species tested

Fifty plant species (crops and weeds) in 11 plant families, including Amaranthaceae, Brassicaceae, Chenopodiaceae, Cucurbitaceae, Gramineae, Leguminosae, Liliaceae, Malvaceae, Purtulaceae, Solanaceae, and Umbelliferae were tested to determine their susceptibility to X. cucurbitae.

Plant inoculation

Plants with cylindrical and pinnate leaves were inoculated by spraying the inoculum onto the leaves. Ten milliliters of inoculum were sprayed onto each plant. Plants with broad leaves were inoculated by infiltration of bacterial suspension into the leaf. For each plant species, three plants and two leaves on each plant were inoculated. Development of symptoms (water-soaked and necrotic lesions) was recorded daily.

Reisolation of X. cucurbitae from inoculated plants

Symptomatic leaves were collected from inoculated plants. Infected tissues were cultured on the KC-agar medium. After 3 days, Xanthomonad-like yellow colonies were subcultured by streaking onto the LB agar medium. Identification of the isolates was accomplished by culturing on yeast dextrose calcium carbonate (YDC) agar medium and a PCR test using primers RST2/3 (5’AGGCCCTGGAAGGTGCCCTGGA3′ and 5’ATCGCACTGCGTACCGCGCGCGA3′).

Determining Seed-Borne Aspect of Xanthomonas cucurbitae

Seed sources

Pumpkin seeds were collected from three different sources: (i) 17 commercial pumpkin fields in Illinois; (ii) plots of three pumpkin research trials at the University of Illinois Vegetable Research Farm (Veg Farm) in Champaign, IL; and (iii) three commercial seed companies. During 2010, 17 commercial pumpkin fields were surveyed in Illinois. Ten fruit with bacterial spot were collected from each field. In 2012, pumpkin fruit with bacterial spot were collected from non-chemical treated plots of three research trials. In 2013, nine pumpkin seed lots were obtained from three seed companies.

Isolation of X. cucurbitae from whole seed

A washing saline solution (WSS) was prepared by adding 7.5 g of NaCl and 200 µl of Tween 20 to 1000 ml distilled water and then sterilized by autoclaving. Three thousand seeds from each lot were tested for presence of X. cucurbitae. Wash suspension of seeds was filtered through sterile cheesecloth and rinsed with 50 ml of sterilized distilled water (SDW). One hundred ml of collected suspension was centrifuged. The pellet was dissolved in buffer. Serial dilutions were prepared from the suspension and 100 µl of the solution was spread on semi-selective kasugamycin-cephalexin (KC)-agar medium in Petri plates. Xanthomonad-like yellow colonies were subcultured on Luria Bertani (LB) agar medium for the identification process of X. cucurbitae.

Seedling infection by seedborne inoculum

Three seed lots that had been collected from severely infected fruits of pumpkin cultivar Howden, and proven to have infected seed with X. cucurbitae, were tested to determine seedling infection by seedborne inoculum. Six hundred forty seeds from each seed lot were sown in plastic trays (40 seeds per tray of 12x40x60cm) containing a mixture of soil:peat:perlite (1:2:1). The trays were placed in a greenhouse at 24-28°C and watered three times a day. Development of the bacterial lesions was recorded daily until 21 days after seedling emergence. Isolation of bacteria from developed lesions was carried out on KC agar medium in Petri plates.

Identification of collected bacterial isolates

Bacterial culture. Bacterial isolates were tested first for Gram reaction using 3% KOH. Isolates with Gram-negative reaction were streaked onto yeast-extract-dextrose-calcium-carbonate agar (YDC) medium.

PCR test. Isolates with Xanthomonad-like yellow colonies, mucoid and dumbed morphology on YDC medium were selected for PCR test. Primers RST2 (5’AGGCCCTGGAAGGTGCCCTGG A3′) and RST3 (5’ATCGCACTGCGTACCGCGCGCGA3′) were used for amplification.

Pathogenicity test. X. cucurbitae isolates that were positively identified by culturing and PCR tests were selected to determine their pathogenicity on pumpkin cultivar Howden in a greenhouse. Selected isolates were cultured on LB agar medium. Bacterial inoculum was prepared and inoculated into leaves. ATCC strain 23378 of X. cucurbitae was inoculated as a positive control. For each isolate, three plants were treated, and on each plant three leaves were inoculated. Inoculated plants were maintained in a greenhouse at 24-28°C. During 3 weeks of inoculation, development of water soaked and necrotic lesions were recorded. Symptomatic tissues were processed for isolation of X. cucurbitae, and the recovered isolates were identified as previously described.

Research results and discussion:

Determining Host-Range

Disease development on plant species

Water soaked chlorotic and necrotic lesions developed in all inoculated plants in the family of Cucurbitaceae, including ‘Acorn’ squash (Cucurbita pepo), ‘burcucumber’ (Sicyos angulatus), ‘Butternut’ squash (Cucurbita moschata), cantaloupe (Cucumis melo), carving pumpkin (Cucurbita maxima), cucumber (Cucumis sativus), gourd (Lagenaria siceraria), honeydew (Cucumis melo), muskmelon (Cucumis melo), pumpkin (Cucurbita pepo), squash (Cucurbita maxima) squash (Cucurbita argyrosperma ), watermelon (Citrullus lanatus), and zucchini (Cucurbita pepo). X. cucurbitae was isolated from the lesions. None of the inoculated plants of non-Cucurbitaceae families developed symptoms. In most of the species, hypersensitive reaction (HR) developed on leaves 1 to 5 days after inoculation.

The results of this study showed that X. cucurbitae infects only species in the Cucurbitaceae family, which agrees with the previous reports. These results also agree with the reports that species of the genus Xanthomonas have relatively limited host ranges and each pathogen usually infects plant species within a single family only.

Determining Seed-Borne Aspect of Xanthomonas cucurbitae

X. cucurbitae was isolated from nine of 17 seed lots collected from commercial fields and three seed lots from experimental plots at the Vegetable Research Farm (Veg Farm). X. cucurbitae was not detected in the seed lots obtained from commercial seed companies.

Seedling infection by seedborne inoculum

Water-soaked necrotic lesions with a yellow halo developed on the cotyledons of plants grown from seeds of all three lots. X. cucurbitae was isolated from the lesions on cotyledons on KC agar medium and identification of X. cucurbitae was confirmed.

X. cucurbitae was isolated from the seed samples harvested from the commercial pumpkin fields and University of Illinois Vegetable Research Farm. In addition, the results proved that X. cucurbitae can be transmitted from the naturally infected seed to the seedling. These data indicate that X. cucurbitae is a seed-borne pathogen.

This study showed that 53% of the seed lots collected from commercial pumpkin fields had infected seed with X. cucurbitae. Also, the greenhouse experiment showed that X. cucurbitae moves from infected seeds to seedlings. Thus, saving seeds by growers from their own pumpkin fields, and planting them in following season could result in plant infection by X. cucurbitae.

X. cucurbitae was not detected in any of the seed lots from commercial seed companies. The results indicated that seeds from certified fields are free of X. cucurbitae. However, only nine seed lots, and from only three companies, were tested in this study. Testing additional seed lots produced in different location may result in discovery of X. cucurbitae in the seeds.

Participation Summary

Educational & Outreach Activities

Participation Summary

Education/outreach description:

Publications:

1. Ravanlou, A. and Babadoost, M. 2010. Incidence of bacterial spot (Xanthomonas campestris pv. cucurbitae) on pumpkins in Illinois. Annual meeting of the American Phytopathological Society, Aug 7-11, Charlotte, NC. Abstract 409P.

2. Babadoost, M. 2010. New vegetable diseases in Illinois. Agronomy Day 2010, the 54rd Annual Agronomy Day, Dept. of Crop Sciences, UIUC, the Crop Science Research and Education Center, Urbana, IL: 36-37.

3. Babadoost, M., and Ravanlou, A. 2010. Bacterial spot (Xanthomonas campestris pv. cucurbitae): a serious threat to the pumpkin industry in Illinois. Proceedings of the Cucurbitaceae 2010, 14-18 November 2010, Charleston, South Carolina, USA. Pages 219-221.

4. Babadoost, M. 2011. Bacterial diseases of cucurbits. Illinois Fruit and Vegetable News, Volume 17, Number 6: 57-60.

5. Babadoost, M. 2011. Identification and management of bacterial diseases of cucurbits. Agronomy Day 2011, the 55rd Annual Agronomy Day, Dept. of Crop Sciences, UIUC, the Crop Science Research and Education Center, Urbana, IL: 42-43.

6. Ravanlou, A., and Babadoost, M. 2011. Bacterial spot (Xanthomonas cucurbitae): an emerging disease of pumpkin in Illinois. Annual meeting of the American Phytopathological Society, Aug 6-10, Honolulu, HI. Abstract 97O.

7. Babadoost, M., Ravanlou, A., Jurgens, A.G., Islam, S.Z. 2011. Improving Plant Disease Management by Molecular Analysis of the Pathogen. 1st Biotechnology World Congress, 28-30 October 2011. Changchun, China. Proceedings of the Congress: page 18.

8. Babadoost, M. 2011. Bacterial spot of pumpkin. Illinois Fruit and Vegetable News, Volume 17, Number 17: 148-149.

9. Babadoost, M., Ravanlou, A. 2012. Outbreak of Bacterial Spot (Xanthomonas cucurbitae) in Pumpkin Fields in Illinois. Plant Disease 96: 1222.

10. Babadoost, M., and Ravanlou, A. 2012. Bacterial spot (Xanthomonas cucurbitae): an emerging disease of pumpkins in the Midwest. Annual Conference of the American Society for Horticultural Sciences, July 31- August 3, 2012. Abstracts of papers: page 61.

11. Babadoost, M., Ravanlou, A., Egel, D.S., and O’Brien, D. 2012. Occurrence of bacterial spot (Xanthomonas cucurbitae) in pumpkin fields in the Midwest. Annual Meeting og the American Phytopathological Society, Providence, RI, August 4-8, 2012. Abstracts of papers: page 19 (97-O).

12. Babadoost, M., Ravanlou, A. 2012. Bacterial spot (Xanthomonas cucurbitae): An emerging pumpkin disease in Illinois. Agronomy Day 2012, the 56rd Annual Agronomy Day, Dept. of Crop Sciences, UIUC, the Crop Science Research and Education Center, Urbana, IL: 35.

13. Babadoost, M., Ravanlou, A. 2012. Bacterial spot (Xanthomonas cucurbitae): an emerging disease of cucurbits in the United States. Cucurbitaceae 2012, Antalya, Turkey October 15-18, 2012. Proceeding of the papers: 190-195.

14. Babadoost, M. 2012. Fact Sheet (RPD): 949-Bacterial Spot of Cucurbits: 2 pp.

15. Babadoost, M. 2013. A report of vegetable diseases in Illinois. Illinois Fruit and Vegetable News, Volume 19, Number 11:107-111.

Presentations: 12 presentations in the meetings in Illinois, United States, and worldwide. Presentations were for growers; seed, chemical, and processing industries.

 

Project Outcomes

Project outcomes:

Now, we know the host-range of Xanthomonas cucurbitae. Thus, after determining survival of the pathogen in the field, we will be able to offer effective crop rotations for managing bacterial spot of pumpkin.

Also, the results of this study showed that Xanthomonas cucurbitae is carried on and in the seed and infected seed give rise to infected plants. So, planting pathogen-free seed is essential for managing bacterial spot in pumpkin.

Economic Analysis

The values of products of processing pumpkins are about $11,000 per acre. The farm-gate value of jack-o-lantern pumpkins varies from $1,500 to $6,000 (average $4,000) per acre. Yield losses in the fields ranges from 0 to 70%. Estimated average yield losses in pumpkin fields is 10%. Thus, the loss in each acre exceeds >$400 per acre.

Farmer Adoption

Farmers have strictly adapted using pathogen-free seed. We are still working on developing effective crop rotation and managing the pathogen by application of chemicals and biocontrol agents.

Recommendations:

Areas needing additional study

The following studies are needed:

1. Determining survival of Xanthomonas cucurbitae in the field.

2. Determining efficacy of chemicals and biocontrol agents for control of Xanthomonas cucurbitae in the field,

3. Developing effective seed treatment of Xanthomonas cucurbitae in the field.

4. Determining genetic and pathogenic variation among isolates of Xanthomonas cucurbitae.

Any opinions, findings, conclusions, or recommendations expressed in this publication are those of the author(s) and do not necessarily reflect the view of the U.S. Department of Agriculture or SARE.